EMAIL THIS PAGE TO A FRIEND

ABL2

c-abl oncogene 2, non-receptor tyrosine kinase

126 Gene Product Result for
Synonyms: ABLL ARG
Gene ID:
Human(27) Summary: This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(11352) v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
Rat(304883) c-abl oncogene 2, non-receptor tyrosine kinase
sheep(101121110) v-abl Abelson murine leukemia viral oncogene homolog 2
Domestic Rabbit(100348328) v-abl Abelson murine leukemia viral oncogene homolog 2
domestic guinea pig(100714234) v-abl Abelson murine leukemia viral oncogene homolog 2
naked mole-rat(101704827) v-abl Abelson murine leukemia viral oncogene homolog 2
Zebrafish(570636) v-abl Abelson murine leukemia viral oncogene homolog 2
cow(511845) v-abl Abelson murine leukemia viral oncogene homolog 2
Horse(100053033) v-abl Abelson murine leukemia viral oncogene homolog 2
domestic cat(101080757) v-abl Abelson murine leukemia viral oncogene homolog 2
chicken(395410) v-abl Abelson murine leukemia viral oncogene homolog 2
dog(480052) v-abl Abelson murine leukemia viral oncogene homolog 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305992 ANTI-ABL (Y251) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1409110 Anti-ABL2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411998 ANTI-ABL2 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411999 ANTI-ABL2 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412281 ANTI-ABL2 antibody produced in mouse clone 5C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412323 ANTI-ABL2 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412446 ANTI-ABL2 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001866 Anti-ABL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4504330 Anti-phospho-Abl (pTyr393/412) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503849 Anti-phospho-Abl (pTyr412) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300273 Anti-phospho-ABL1/ABL2 (pTyr393/429) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0000027M9 Monoclonal Anti-ABL2 antibody produced in mouse clone 5C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403515 Monoclonal Anti-ABL2 antibody produced in mouse clone 6D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300521 Monoclonal Anti-ABL2 antibody produced in mouse clone 1H1B11, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB5300522 Monoclonal Anti-ABL2 antibody produced in mouse clone 1H1, ascites fluid mouse, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_009595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014941 MISSION® esiRNA esiRNA targeting human ABL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100108 Rosetta Predictions human pricing
NM_005158 Rosetta Predictions human pricing
NM_007314 Rosetta Predictions human pricing
NM_001107186 Rosetta Predictions rat pricing
NM_009595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321624 predicted 1360
2 SASI_Hs02_00321625 predicted 2763
3 SASI_Hs02_00321626 predicted 1268
4 SASI_Hs02_00321627 predicted 1456
5 SASI_Hs02_00321628 predicted 988
6 SASI_Hs02_00321629 predicted 3196
7 SASI_Hs02_00321630 predicted 998
8 SASI_Hs02_00321631 predicted 631
9 SASI_Hs02_00321632 predicted 875
10 SASI_Hs02_00321633 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035916 predicted 1295
2 SASI_Hs01_00035917 predicted 2708
3 SASI_Hs02_00339098 predicted 1200
4 SASI_Hs01_00035919 predicted 1399
5 SASI_Hs01_00035920 predicted 928
6 SASI_Hs02_00339099 predicted 3133
7 SASI_Hs01_00035921 predicted 934
8 SASI_Hs01_00035922 predicted 571
9 SASI_Hs01_00035923 predicted 809
10 SASI_Hs01_00035924 predicted 947
11 SASI_Hs01_00035918 predicted 3090
12 SASI_Hs01_00035925 predicted 2924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130008 predicted 1606
2 SASI_Hs02_00343384 predicted 2279
3 SASI_Hs01_00130011 predicted 1707
4 SASI_Hs01_00130012 predicted 1237
5 SASI_Hs02_00343385 predicted 3447
6 SASI_Hs01_00130013 predicted 1250
7 SASI_Hs01_00130014 predicted 876
8 SASI_Hs01_00130015 predicted 1122
9 SASI_Hs01_00130016 predicted 1249
10 SASI_Hs02_00343386 predicted 2623
11 SASI_Hs01_00130009 predicted 2987
12 SASI_Hs01_00130010 predicted 3399
13 SASI_Hs01_00130017 predicted 3227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226355 predicted 707
2 SASI_Rn02_00226356 predicted 350
3 SASI_Rn02_00226357 predicted 3359
4 SASI_Rn02_00226358 predicted 263
5 SASI_Rn02_00226359 predicted 309
6 SASI_Rn02_00226360 predicted 1005
7 SASI_Rn02_00226361 predicted 1859
8 SASI_Rn02_00226362 predicted 466
9 SASI_Rn02_00226363 predicted 3415
10 SASI_Rn02_00226364 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020693 predicted 1453
2 SASI_Mm02_00316508 predicted 3418
3 SASI_Mm01_00020694 predicted 468
4 SASI_Mm01_00020695 predicted 1437
5 SASI_Mm01_00020696 predicted 839
6 SASI_Mm01_00020697 predicted 1872
7 SASI_Mm01_00020698 predicted 322
8 SASI_Mm01_00020699 predicted 821
9 SASI_Mm01_00020700 predicted 809
10 SASI_Mm02_00316509 predicted 3488
11 SASI_Mm01_00020701 predicted 3218
12 SASI_Mm01_00020702 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005158
VALIDATED
ABL2 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 2, non-receptor tyrosine kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.2-655s1c1
Sequence:CCGGGATGGGCTGGTGACAACATTACTCGAGTAATGTTGTCACCAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1524s1c1
Sequence:CCGGGTTCCATGACTCCAGCATTTCCTCGAGGAAATGCTGGAGTCATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1337s1c1
Sequence:CCGGCCTATGGAATGTCACCATATCCTCGAGGATATGGTGACATTCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1431s1c1
Sequence:CCGGCCCTAAGGTTTATGAACTTATCTCGAGATAAGTTCATAAACCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-156s1c1
Sequence:CCGGCCAGGCACTAAATGAGGCTATCTCGAGATAGCCTCATTTAGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-786s1c1
Sequence:CCGGCGGTCAGTATGGAGAGGTTTACTCGAGTAAACCTCTCCATACTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-3279s1c1
Sequence:CCGGCCCTCAAACTCGCAACAAATTCTCGAGAATTTGTTGCGAGTTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-750s1c1
Sequence:CCGGGCGAACAGATATTACCATGAACTCGAGTTCATGGTAATATCTGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-1580s1c1
Sequence:CCGGCCTCGTCATCTGTTGTTCCATCTCGAGATGGAACAACAGATGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3304s21c1
Sequence:CCGGTCCCTCAAACTCGCAACAAATCTCGAGATTTGTTGCGAGTTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3407s21c1
Sequence:GTACCGGGACAAACCCTGTCCTTAATAACTCGAGTTATTAAGGACAGGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005158.3-2174s21c1
Sequence:GTACCGGCTTCTTTACACCACGCTTAATCTCGAGATTAAGCGTGGTGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-6038s21c1
Sequence:CCGGTACAGTGGGTGCACGATATATCTCGAGATATATCGTGCACCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-1010s21c1
Sequence:CCGGATACATGCCATACGGGAATTTCTCGAGAAATTCCCGTATGGCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005158
VALIDATED
ABL2 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 2, non-receptor tyrosine kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.2-655s1c1
Sequence:CCGGGATGGGCTGGTGACAACATTACTCGAGTAATGTTGTCACCAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1524s1c1
Sequence:CCGGGTTCCATGACTCCAGCATTTCCTCGAGGAAATGCTGGAGTCATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1337s1c1
Sequence:CCGGCCTATGGAATGTCACCATATCCTCGAGGATATGGTGACATTCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1431s1c1
Sequence:CCGGCCCTAAGGTTTATGAACTTATCTCGAGATAAGTTCATAAACCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-156s1c1
Sequence:CCGGCCAGGCACTAAATGAGGCTATCTCGAGATAGCCTCATTTAGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-786s1c1
Sequence:CCGGCGGTCAGTATGGAGAGGTTTACTCGAGTAAACCTCTCCATACTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-3279s1c1
Sequence:CCGGCCCTCAAACTCGCAACAAATTCTCGAGAATTTGTTGCGAGTTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-750s1c1
Sequence:CCGGGCGAACAGATATTACCATGAACTCGAGTTCATGGTAATATCTGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-1580s1c1
Sequence:CCGGCCTCGTCATCTGTTGTTCCATCTCGAGATGGAACAACAGATGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3304s21c1
Sequence:CCGGTCCCTCAAACTCGCAACAAATCTCGAGATTTGTTGCGAGTTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3407s21c1
Sequence:GTACCGGGACAAACCCTGTCCTTAATAACTCGAGTTATTAAGGACAGGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005158.3-2174s21c1
Sequence:GTACCGGCTTCTTTACACCACGCTTAATCTCGAGATTAAGCGTGGTGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-6038s21c1
Sequence:CCGGTACAGTGGGTGCACGATATATCTCGAGATATATCGTGCACCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-1010s21c1
Sequence:CCGGATACATGCCATACGGGAATTTCTCGAGAAATTCCCGTATGGCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005158
VALIDATED
ABL2 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 2, non-receptor tyrosine kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.2-655s1c1
Sequence:CCGGGATGGGCTGGTGACAACATTACTCGAGTAATGTTGTCACCAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1524s1c1
Sequence:CCGGGTTCCATGACTCCAGCATTTCCTCGAGGAAATGCTGGAGTCATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1337s1c1
Sequence:CCGGCCTATGGAATGTCACCATATCCTCGAGGATATGGTGACATTCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.2-1431s1c1
Sequence:CCGGCCCTAAGGTTTATGAACTTATCTCGAGATAAGTTCATAAACCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-156s1c1
Sequence:CCGGCCAGGCACTAAATGAGGCTATCTCGAGATAGCCTCATTTAGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-786s1c1
Sequence:CCGGCGGTCAGTATGGAGAGGTTTACTCGAGTAAACCTCTCCATACTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-3279s1c1
Sequence:CCGGCCCTCAAACTCGCAACAAATTCTCGAGAATTTGTTGCGAGTTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005158.x-750s1c1
Sequence:CCGGGCGAACAGATATTACCATGAACTCGAGTTCATGGTAATATCTGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005158.x-1580s1c1
Sequence:CCGGCCTCGTCATCTGTTGTTCCATCTCGAGATGGAACAACAGATGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3304s21c1
Sequence:CCGGTCCCTCAAACTCGCAACAAATCTCGAGATTTGTTGCGAGTTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-3407s21c1
Sequence:GTACCGGGACAAACCCTGTCCTTAATAACTCGAGTTATTAAGGACAGGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005158.3-2174s21c1
Sequence:GTACCGGCTTCTTTACACCACGCTTAATCTCGAGATTAAGCGTGGTGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-6038s21c1
Sequence:CCGGTACAGTGGGTGCACGATATATCTCGAGATATATCGTGCACCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005158.3-1010s21c1
Sequence:CCGGATACATGCCATACGGGAATTTCTCGAGAAATTCCCGTATGGCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136360
VALIDATED
ABL2 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000023344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-2452s1c1
Sequence:CCGGGCTTCTTTACACCTCGATTAACTCGAGTTAATCGAGGTGTAAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-525s1c1
Sequence:CCGGCCTAATCTCTTTGTTGCACTTCTCGAGAAGTGCAACAAAGAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-1019s1c1
Sequence:CCGGCGTGTCTCCTATCCATGACAACTCGAGTTGTCATGGATAGGAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136360
VALIDATED
ABL2 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000023344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-2452s1c1
Sequence:CCGGGCTTCTTTACACCTCGATTAACTCGAGTTAATCGAGGTGTAAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-525s1c1
Sequence:CCGGCCTAATCTCTTTGTTGCACTTCTCGAGAAGTGCAACAAAGAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-1019s1c1
Sequence:CCGGCGTGTCTCCTATCCATGACAACTCGAGTTGTCATGGATAGGAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136360
VALIDATED
ABL2 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000023344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-2452s1c1
Sequence:CCGGGCTTCTTTACACCTCGATTAACTCGAGTTAATCGAGGTGTAAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-525s1c1
Sequence:CCGGCCTAATCTCTTTGTTGCACTTCTCGAGAAGTGCAACAAAGAGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_136360.2-1019s1c1
Sequence:CCGGCGTGTCTCCTATCCATGACAACTCGAGTTGTCATGGATAGGAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009595
VALIDATED
ABL2 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009595.3-2518s21c1
Sequence:CCGGCTTCTTTACACCTCGATTAATCTCGAGATTAATCGAGGTGTAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009595.3-4061s21c1
Sequence:CCGGGATTAGGGAGCCTCGTGTATACTCGAGTATACACGAGGCTCCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009595.3-1623s21c1
Sequence:CCGGCCGAGAGTCTGGCCTACAATACTCGAGTATTGTAGGCCAGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009595
VALIDATED
ABL2 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009595.3-2518s21c1
Sequence:CCGGCTTCTTTACACCTCGATTAATCTCGAGATTAATCGAGGTGTAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009595.3-4061s21c1
Sequence:CCGGGATTAGGGAGCCTCGTGTATACTCGAGTATACACGAGGCTCCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009595.3-1623s21c1
Sequence:CCGGCCGAGAGTCTGGCCTACAATACTCGAGTATTGTAGGCCAGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009595
VALIDATED
ABL2 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 2, non-receptor tyrosine kinase
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009595.3-2518s21c1
Sequence:CCGGCTTCTTTACACCTCGATTAATCTCGAGATTAATCGAGGTGTAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009595.3-4061s21c1
Sequence:CCGGGATTAGGGAGCCTCGTGTATACTCGAGTATACACGAGGCTCCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009595.3-1623s21c1
Sequence:CCGGCCGAGAGTCTGGCCTACAATACTCGAGTATTGTAGGCCAGACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks