EMAIL THIS PAGE TO A FRIEND

ABLIM1

actin binding LIM protein 1

215 Gene Product Result for
Synonyms: ABLIM LIMAB1 LIMATIN abLIM-1
Gene ID:
Human(3983) Summary: This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(226251) actin-binding LIM protein 1
Rat(307989) actin-binding LIM protein 1
chicken(423911) actin binding LIM protein 1
dog(477828) actin binding LIM protein 1
Horse(100058994) actin binding LIM protein 1
cow(504968) actin binding LIM protein 1
domestic cat(101082187) actin binding LIM protein 1
naked mole-rat(101703529) actin binding LIM protein 1
domestic guinea pig(100718513) actin binding LIM protein 1
sheep(101102193) actin binding LIM protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003407 Rosetta Predictions human pricing
NM_001003408 Rosetta Predictions human pricing
NM_002313 Rosetta Predictions human pricing
NM_006720 Rosetta Predictions human pricing
NM_001044394 Rosetta Predictions rat pricing
NM_001103177 Rosetta Predictions mouse pricing
NM_001103178 Rosetta Predictions mouse pricing
NM_178688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097968 predicted 2013
2 SASI_Hs01_00097969 predicted 2053
3 SASI_Hs01_00097971 predicted 2037
4 SASI_Hs01_00097972 predicted 1866
5 SASI_Hs01_00097973 predicted 2245
6 SASI_Hs01_00097974 predicted 1921
7 SASI_Hs01_00097975 predicted 2233
8 SASI_Hs01_00097976 predicted 2366
9 SASI_Hs01_00097977 predicted 1965
10 SASI_Hs02_00304286 predicted 2510
11 SASI_Hs01_00097970 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222122 predicted 2098
2 SASI_Hs01_00222123 predicted 2141
3 SASI_Hs01_00222125 predicted 2122
4 SASI_Hs01_00222126 predicted 1952
5 SASI_Hs01_00222127 predicted 2330
6 SASI_Hs01_00222128 predicted 2004
7 SASI_Hs01_00222129 predicted 2316
8 SASI_Hs01_00222130 predicted 2450
9 SASI_Hs01_00222131 predicted 2045
10 SASI_Hs02_00304287 predicted 2595
11 SASI_Hs01_00222124 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059596 predicted 1993
2 SASI_Hs01_00059597 predicted 2034
3 SASI_Hs01_00059599 predicted 2021
4 SASI_Hs01_00059600 predicted 1851
5 SASI_Hs01_00059601 predicted 2218
6 SASI_Hs01_00059602 predicted 1895
7 SASI_Hs01_00059603 predicted 2203
8 SASI_Hs01_00059604 predicted 2349
9 SASI_Hs01_00059605 predicted 1941
10 SASI_Hs02_00333631 predicted 2487
11 SASI_Hs01_00059598 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200186 predicted 1237
2 SASI_Hs01_00200187 predicted 1284
3 SASI_Hs01_00200189 predicted 1273
4 SASI_Hs01_00200190 predicted 1099
5 SASI_Hs01_00200191 predicted 1474
6 SASI_Hs01_00200192 predicted 1153
7 SASI_Hs01_00200193 predicted 1458
8 SASI_Hs01_00200194 predicted 1595
9 SASI_Hs01_00200195 predicted 1188
10 SASI_Hs02_00342156 predicted 1737
11 SASI_Hs01_00200188 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205714 predicted 1320
2 SASI_Rn02_00205715 predicted 1303
3 SASI_Rn02_00205716 predicted 734
4 SASI_Rn02_00205717 predicted 1189
5 SASI_Rn02_00205718 predicted 295
6 SASI_Rn02_00205719 predicted 1467
7 SASI_Rn02_00205720 predicted 934
8 SASI_Rn02_00205721 predicted 508
9 SASI_Rn02_00205722 predicted 341
10 SASI_Rn02_00205723 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303174 predicted 2072
2 SASI_Mm02_00303175 predicted 2116
3 SASI_Mm02_00303176 predicted 1946
4 SASI_Mm02_00303177 predicted 2282
5 SASI_Mm02_00303178 predicted 2188
6 SASI_Mm02_00303179 predicted 2065
7 SASI_Mm02_00303180 predicted 2049
8 SASI_Mm02_00303181 predicted 2506
9 SASI_Mm02_00303182 predicted 1762
10 SASI_Mm02_00303183 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303184 predicted 1738
2 SASI_Mm02_00303185 predicted 1782
3 SASI_Mm02_00303186 predicted 1619
4 SASI_Mm02_00303187 predicted 1952
5 SASI_Mm02_00303188 predicted 1854
6 SASI_Mm02_00303189 predicted 1726
7 SASI_Mm02_00303190 predicted 1719
8 SASI_Mm02_00303191 predicted 2166
9 SASI_Mm02_00303192 predicted 1423
10 SASI_Mm02_00303193 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349170 predicted 2450
2 SASI_Mm02_00349171 predicted 2489
3 SASI_Mm02_00349172 predicted 2323
4 SASI_Mm02_00349173 predicted 2667
5 SASI_Mm02_00349174 predicted 2566
6 SASI_Mm02_00349175 predicted 2439
7 SASI_Mm01_00056573 predicted 2431
8 SASI_Mm02_00349176 predicted 2881
9 SASI_Mm02_00349177 predicted 2135
10 SASI_Mm02_00349178 predicted 2946
11 SASI_Mm01_00056565 predicted 811
12 SASI_Mm01_00056566 predicted 815
13 SASI_Mm01_00056567 predicted 426
14 SASI_Mm01_00056568 predicted 1589
15 SASI_Mm01_00056569 predicted 1448
16 SASI_Mm01_00056570 predicted 241
17 SASI_Mm01_00056571 predicted 1595
18 SASI_Mm01_00056572 predicted 1015
19 SASI_Mm01_00056574 predicted 1872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002313
VALIDATED
ABLIM1 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1195s21c1
Sequence:CCGGGGCTCACCAGGTCATACTATCCTCGAGGATAGTATGACCTGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1292s21c1
Sequence:CCGGTTGAACGTCCAGATCTTATTACTCGAGTAATAAGATCTGGACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1267s21c1
Sequence:CCGGCCGAAGGTCAAGGCAATTTATCTCGAGATAAATTGCCTTGACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-432s21c1
Sequence:CCGGTCGGGTCCAGACCAAACATTTCTCGAGAAATGTTTGGTCTGGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-4014s1c1
Sequence:CCGGGCCACTTTATTATCATGCTTTCTCGAGAAAGCATGATAATAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-382s1c1
Sequence:CCGGCCTGTCATTCACTGCCATAAACTCGAGTTTATGGCAGTGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2220s1c1
Sequence:CCGGGCCCAACATGTTGGAACCAAACTCGAGTTTGGTTCCAACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2334s1c1
Sequence:CCGGCCCTGAAGTGTTTCGGGAAATCTCGAGATTTCCCGAAACACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-1154s1c1
Sequence:CCGGCCTCGGAAAGTATTTATTCTACTCGAGTAGAATAAATACTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002313
VALIDATED
ABLIM1 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1195s21c1
Sequence:CCGGGGCTCACCAGGTCATACTATCCTCGAGGATAGTATGACCTGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1292s21c1
Sequence:CCGGTTGAACGTCCAGATCTTATTACTCGAGTAATAAGATCTGGACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1267s21c1
Sequence:CCGGCCGAAGGTCAAGGCAATTTATCTCGAGATAAATTGCCTTGACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-432s21c1
Sequence:CCGGTCGGGTCCAGACCAAACATTTCTCGAGAAATGTTTGGTCTGGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-4014s1c1
Sequence:CCGGGCCACTTTATTATCATGCTTTCTCGAGAAAGCATGATAATAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-382s1c1
Sequence:CCGGCCTGTCATTCACTGCCATAAACTCGAGTTTATGGCAGTGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2220s1c1
Sequence:CCGGGCCCAACATGTTGGAACCAAACTCGAGTTTGGTTCCAACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2334s1c1
Sequence:CCGGCCCTGAAGTGTTTCGGGAAATCTCGAGATTTCCCGAAACACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-1154s1c1
Sequence:CCGGCCTCGGAAAGTATTTATTCTACTCGAGTAGAATAAATACTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002313
VALIDATED
ABLIM1 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1195s21c1
Sequence:CCGGGGCTCACCAGGTCATACTATCCTCGAGGATAGTATGACCTGGTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1292s21c1
Sequence:CCGGTTGAACGTCCAGATCTTATTACTCGAGTAATAAGATCTGGACGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-1267s21c1
Sequence:CCGGCCGAAGGTCAAGGCAATTTATCTCGAGATAAATTGCCTTGACCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002313.5-432s21c1
Sequence:CCGGTCGGGTCCAGACCAAACATTTCTCGAGAAATGTTTGGTCTGGACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-4014s1c1
Sequence:CCGGGCCACTTTATTATCATGCTTTCTCGAGAAAGCATGATAATAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-382s1c1
Sequence:CCGGCCTGTCATTCACTGCCATAAACTCGAGTTTATGGCAGTGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2220s1c1
Sequence:CCGGGCCCAACATGTTGGAACCAAACTCGAGTTTGGTTCCAACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002313.5-2334s1c1
Sequence:CCGGCCCTGAAGTGTTTCGGGAAATCTCGAGATTTCCCGAAACACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002313.5-1154s1c1
Sequence:CCGGCCTCGGAAAGTATTTATTCTACTCGAGTAGAATAAATACTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178688
VALIDATED
ABLIM1 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1999s21c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1428s21c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1311s21c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1259s21c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1259s1c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1428s1c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-2130s1c1
Sequence:CCGGGCTTCAAGAAGAACAGTTGATCTCGAGATCAACTGTTCTTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1311s1c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1999s1c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178688
VALIDATED
ABLIM1 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1999s21c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1428s21c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1311s21c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1259s21c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1259s1c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1428s1c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-2130s1c1
Sequence:CCGGGCTTCAAGAAGAACAGTTGATCTCGAGATCAACTGTTCTTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1311s1c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1999s1c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178688
VALIDATED
ABLIM1 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1999s21c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1428s21c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1311s21c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178688.3-1259s21c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1259s1c1
Sequence:CCGGCCTCCTCTGAAAGTATCTATTCTCGAGAATAGATACTTTCAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1428s1c1
Sequence:CCGGGCCTTTCTACACATCAGGCTACTCGAGTAGCCTGATGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-2130s1c1
Sequence:CCGGGCTTCAAGAAGAACAGTTGATCTCGAGATCAACTGTTCTTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1311s1c1
Sequence:CCGGAGGCCATACTATCTATGCAAACTCGAGTTTGCATAGATAGTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178688.2-1999s1c1
Sequence:CCGGCCCAACGAGATACCAAAGATTCTCGAGAATCTTTGGTATCTCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks