EMAIL THIS PAGE TO A FRIEND

ABLIM2

actin binding LIM protein family, member 2

74 Gene Product Result for
Gene ID:
Mouse(231148) actin-binding LIM protein 2
Rat(360958) actin binding LIM protein family, member 2
Zebrafish(568454) actin binding LIM protein family, member 2
chicken(422866) actin binding LIM protein family, member 2
dog(610389) actin binding LIM protein family, member 2
cow(618227) actin binding LIM protein family, member 2
domestic cat(101089513) actin binding LIM protein family, member 2
sheep(101118876) actin binding LIM protein family, member 2
domestic guinea pig(100716117) actin binding LIM protein family, member 2
naked mole-rat(101717976) actin binding LIM protein family, member 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035808 Anti-ABLIM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032432 Rosetta Predictions human pricing
NM_001001514 Rosetta Predictions rat pricing
XM_579058 Rosetta Predictions rat pricing
NM_177678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010461 predicted 2076
2 SASI_Hs01_00010462 predicted 1870
3 SASI_Hs02_00359837 predicted 1492
4 SASI_Hs01_00010463 predicted 880
5 SASI_Hs01_00010464 predicted 498
6 SASI_Hs01_00010465 predicted 685
7 SASI_Hs01_00010466 predicted 728
8 SASI_Hs01_00010467 predicted 1553
9 SASI_Hs01_00010468 predicted 978
10 SASI_Hs01_00010469 predicted 2076
11 SASI_Hs01_00010470 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070163 predicted 744
2 SASI_Rn01_00070164 predicted 1663
3 SASI_Rn01_00070165 predicted 549
4 SASI_Rn02_00197915 predicted 1774
5 SASI_Rn01_00070169 predicted 1723
6 SASI_Rn01_00070170 predicted 355
7 SASI_Rn01_00070171 predicted 1670
8 SASI_Rn01_00070172 predicted 1684
9 SASI_Rn02_00197916 predicted 1692
10 SASI_Rn02_00197917 predicted 960
11 SASI_Rn01_00070166 predicted 765
12 SASI_Rn01_00070167 predicted 230
13 SASI_Rn01_00070168 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192196 predicted 748
2 SASI_Rn01_00192197 predicted 1675
3 SASI_Rn01_00192198 predicted 559
4 SASI_Rn01_00192199 predicted 764
5 SASI_Rn01_00192200 predicted 231
6 SASI_Rn01_00192201 predicted 708
7 SASI_Rn01_00192202 predicted 1722
8 SASI_Rn01_00192203 predicted 362
9 SASI_Rn01_00192204 predicted 1679
10 SASI_Rn01_00192205 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095491 predicted 1107
2 SASI_Mm01_00095492 predicted 724
3 SASI_Mm01_00095493 predicted 662
4 SASI_Mm01_00095494 predicted 1747
5 SASI_Mm01_00095495 predicted 323
6 SASI_Mm01_00095496 predicted 1768
7 SASI_Mm01_00095497 predicted 1799
8 SASI_Mm01_00095498 predicted 1840
9 SASI_Mm01_00095499 predicted 334
10 SASI_Mm01_00095500 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032432
ABLIM2 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein family, member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-1112s1c1
Sequence:CCGGGATCTCCTACTCACCCTACATCTCGAGATGTAGGGTGAGTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-858s1c1
Sequence:CCGGGCAGAAGGCGAAGAGATGTATCTCGAGATACATCTCTTCGCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-861s1c1
Sequence:CCGGGAAGGCGAAGAGATGTATCTTCTCGAGAAGATACATCTCTTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-3257s1c1
Sequence:CCGGCCTAATATGCTTCCTGCCATTCTCGAGAATGGCAGGAAGCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-1011s1c1
Sequence:CCGGCGTGTGATTTATGCCAAGCTTCTCGAGAAGCTTGGCATAAATCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-2619s1c1
Sequence:CCGGCCTCTAAAGAACGCTTTGTAACTCGAGTTACAAAGCGTTCTTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1077s21c1
Sequence:CCGGGACTTGGCAGCCCTTCCTAAACTCGAGTTTAGGAAGGGCTGCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-736s21c1
Sequence:CCGGCCTACTGCGAAGCTGACTATCCTCGAGGATAGTCAGCTTCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1501s21c1
Sequence:CCGGACTCACAATACAAGATCTATCCTCGAGGATAGATCTTGTATTGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1337s21c1
Sequence:CCGGTGGAAGCTTGGACCAGGATAACTCGAGTTATCCTGGTCCAAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-610s21c1
Sequence:CCGGGCGGCACAGAAATCAAGAATGCTCGAGCATTCTTGATTTCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032432
ABLIM2 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein family, member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-1112s1c1
Sequence:CCGGGATCTCCTACTCACCCTACATCTCGAGATGTAGGGTGAGTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-858s1c1
Sequence:CCGGGCAGAAGGCGAAGAGATGTATCTCGAGATACATCTCTTCGCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-861s1c1
Sequence:CCGGGAAGGCGAAGAGATGTATCTTCTCGAGAAGATACATCTCTTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-3257s1c1
Sequence:CCGGCCTAATATGCTTCCTGCCATTCTCGAGAATGGCAGGAAGCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-1011s1c1
Sequence:CCGGCGTGTGATTTATGCCAAGCTTCTCGAGAAGCTTGGCATAAATCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-2619s1c1
Sequence:CCGGCCTCTAAAGAACGCTTTGTAACTCGAGTTACAAAGCGTTCTTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1077s21c1
Sequence:CCGGGACTTGGCAGCCCTTCCTAAACTCGAGTTTAGGAAGGGCTGCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-736s21c1
Sequence:CCGGCCTACTGCGAAGCTGACTATCCTCGAGGATAGTCAGCTTCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1501s21c1
Sequence:CCGGACTCACAATACAAGATCTATCCTCGAGGATAGATCTTGTATTGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1337s21c1
Sequence:CCGGTGGAAGCTTGGACCAGGATAACTCGAGTTATCCTGGTCCAAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-610s21c1
Sequence:CCGGGCGGCACAGAAATCAAGAATGCTCGAGCATTCTTGATTTCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032432
ABLIM2 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein family, member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-1112s1c1
Sequence:CCGGGATCTCCTACTCACCCTACATCTCGAGATGTAGGGTGAGTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032432.2-858s1c1
Sequence:CCGGGCAGAAGGCGAAGAGATGTATCTCGAGATACATCTCTTCGCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-861s1c1
Sequence:CCGGGAAGGCGAAGAGATGTATCTTCTCGAGAAGATACATCTCTTCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-3257s1c1
Sequence:CCGGCCTAATATGCTTCCTGCCATTCTCGAGAATGGCAGGAAGCATATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032432.2-1011s1c1
Sequence:CCGGCGTGTGATTTATGCCAAGCTTCTCGAGAAGCTTGGCATAAATCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032432.2-2619s1c1
Sequence:CCGGCCTCTAAAGAACGCTTTGTAACTCGAGTTACAAAGCGTTCTTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1077s21c1
Sequence:CCGGGACTTGGCAGCCCTTCCTAAACTCGAGTTTAGGAAGGGCTGCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-736s21c1
Sequence:CCGGCCTACTGCGAAGCTGACTATCCTCGAGGATAGTCAGCTTCGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1501s21c1
Sequence:CCGGACTCACAATACAAGATCTATCCTCGAGGATAGATCTTGTATTGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-1337s21c1
Sequence:CCGGTGGAAGCTTGGACCAGGATAACTCGAGTTATCCTGGTCCAAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032432.4-610s21c1
Sequence:CCGGGCGGCACAGAAATCAAGAATGCTCGAGCATTCTTGATTTCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177678
ABLIM2 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein family, member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-1011s1c1
Sequence:CCGGCGTGTGATCTACGCAAAGCTTCTCGAGAAGCTTTGCGTAGATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-726s1c1
Sequence:CCGGGCTGATTATCACAGCAAGTTTCTCGAGAAACTTGCTGTGATAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177678.4-2553s1c1
Sequence:CCGGCCCGCTAATGCTCTGTGTATTCTCGAGAATACACAGAGCATTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-188s1c1
Sequence:CCGGCCTGTGTAATACCTGTGGGAACTCGAGTTCCCACAGGTATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177678
ABLIM2 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein family, member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-1011s1c1
Sequence:CCGGCGTGTGATCTACGCAAAGCTTCTCGAGAAGCTTTGCGTAGATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-726s1c1
Sequence:CCGGGCTGATTATCACAGCAAGTTTCTCGAGAAACTTGCTGTGATAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177678.4-2553s1c1
Sequence:CCGGCCCGCTAATGCTCTGTGTATTCTCGAGAATACACAGAGCATTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-188s1c1
Sequence:CCGGCCTGTGTAATACCTGTGGGAACTCGAGTTCCCACAGGTATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177678
ABLIM2 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein family, member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-1011s1c1
Sequence:CCGGCGTGTGATCTACGCAAAGCTTCTCGAGAAGCTTTGCGTAGATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-726s1c1
Sequence:CCGGGCTGATTATCACAGCAAGTTTCTCGAGAAACTTGCTGTGATAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177678.4-2553s1c1
Sequence:CCGGCCCGCTAATGCTCTGTGTATTCTCGAGAATACACAGAGCATTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177678.4-188s1c1
Sequence:CCGGCCTGTGTAATACCTGTGGGAACTCGAGTTCCCACAGGTATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks