EMAIL THIS PAGE TO A FRIEND

ABLIM3

actin binding LIM protein family, member 3

109 Gene Product Result for
UniProtKB ID: O94929, A8K121, Q19VH3, Q658S1, Q68CI5, Q9BV32
Gene ID:
Human(22885) Summary: The LIM domain is a double zinc finger structure that promotes protein-protein interactions. LIM domain proteins, such as ABLIM3, play roles in embryonic development, cell lineage determination, and cancer (Krupp et al., 2006 [PubMed 16328021]
Mouse(319713) actin binding LIM protein family, member 3
Rat(307395) actin binding LIM protein family, member 3
naked mole-rat(101709983) actin binding LIM protein family, member 3
domestic guinea pig(100733826) actin binding LIM protein family, member 3
sheep(101118949) actin binding LIM protein family, member 3
Domestic Rabbit(100339712) actin binding LIM protein family, member 3
Zebrafish(566821) actin binding LIM protein family, member 3
domestic cat(101086700) actin binding LIM protein family, member 3
cow(613794) actin binding LIM protein family, member 3
Horse(100071715) actin binding LIM protein family, member 3
dog(612309) actin binding LIM protein family, member 3
chicken(416201) actin binding LIM protein family, member 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060411 MISSION® esiRNA esiRNA human ABLIM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014945 Rosetta Predictions human pricing
XM_001058944 Rosetta Predictions rat pricing
XM_225889 Rosetta Predictions rat pricing
NM_198649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346619 predicted 258
2 SASI_Hs01_00025265 predicted 1551
3 SASI_Hs01_00025266 predicted 1061
4 SASI_Hs01_00025267 predicted 2091
5 SASI_Hs01_00025268 predicted 1919
6 SASI_Hs01_00025269 predicted 665
7 SASI_Hs01_00025270 predicted 870
8 SASI_Hs01_00025272 predicted 1191
9 SASI_Hs01_00025273 predicted 1058
10 SASI_Hs01_00025274 predicted 1587
11 SASI_Hs01_00025271 predicted 2291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291353 predicted 1035
2 SASI_Rn02_00291354 predicted 1478
3 SASI_Rn02_00291355 predicted 1811
4 SASI_Rn02_00291356 predicted 1846
5 SASI_Rn02_00291357 predicted 2424
6 SASI_Rn02_00291358 predicted 2670
7 SASI_Rn02_00291359 predicted 1381
8 SASI_Rn02_00291360 predicted 2700
9 SASI_Rn02_00291361 predicted 1199
10 SASI_Rn02_00291362 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383210 predicted 1037
2 SASI_Rn02_00383211 predicted 1479
3 SASI_Rn02_00383212 predicted 1814
4 SASI_Rn02_00383213 predicted 1850
5 SASI_Rn02_00383214 predicted 2430
6 SASI_Rn02_00383215 predicted 2675
7 SASI_Rn02_00383216 predicted 1382
8 SASI_Rn02_00383217 predicted 2703
9 SASI_Rn02_00383218 predicted 1197
10 SASI_Rn02_00383219 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035556 predicted 2393
2 SASI_Mm01_00035557 predicted 1446
3 SASI_Mm01_00035558 predicted 1119
4 SASI_Mm01_00035559 predicted 1021
5 SASI_Mm01_00035560 predicted 2666
6 SASI_Mm01_00035561 predicted 2414
7 SASI_Mm01_00035562 predicted 1782
8 SASI_Mm01_00035563 predicted 2639
9 SASI_Mm01_00035564 predicted 2224
10 SASI_Mm01_00035565 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014945
ABLIM3 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2357s21c1
Sequence:CCGGTCTACTGAAGCTCGGTATAATCTCGAGATTATACCGAGCTTCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014945.2-1126s21c1
Sequence:CCGGACCGAGTCATCTGCGCTAAAGCTCGAGCTTTAGCGCAGATGACTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2681s21c1
Sequence:CCGGTGTGGTTTCCACACCTTATTGCTCGAGCAATAAGGTGTGGAAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1742s1c1
Sequence:CCGGCGGCTGATTCTGAAGGAAGAACTCGAGTTCTTCCTTCAGAATCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-597s1c1
Sequence:CCGGCCATCAAGATTCGTGGACCAACTCGAGTTGGTCCACGAATCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014945.1-2362s1c1
Sequence:CCGGGCCCACGTCATCGAGATATTTCTCGAGAAATATCTCGATGACGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1219s1c1
Sequence:CCGGGCTGGGAACATTATCTCCCTACTCGAGTAGGGAGATAATGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-967s1c1
Sequence:CCGGCCGGGCAGAGAAGAAGTTAAACTCGAGTTTAACTTCTTCTCTGCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014945
ABLIM3 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2357s21c1
Sequence:CCGGTCTACTGAAGCTCGGTATAATCTCGAGATTATACCGAGCTTCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014945.2-1126s21c1
Sequence:CCGGACCGAGTCATCTGCGCTAAAGCTCGAGCTTTAGCGCAGATGACTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2681s21c1
Sequence:CCGGTGTGGTTTCCACACCTTATTGCTCGAGCAATAAGGTGTGGAAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1742s1c1
Sequence:CCGGCGGCTGATTCTGAAGGAAGAACTCGAGTTCTTCCTTCAGAATCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-597s1c1
Sequence:CCGGCCATCAAGATTCGTGGACCAACTCGAGTTGGTCCACGAATCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014945.1-2362s1c1
Sequence:CCGGGCCCACGTCATCGAGATATTTCTCGAGAAATATCTCGATGACGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1219s1c1
Sequence:CCGGGCTGGGAACATTATCTCCCTACTCGAGTAGGGAGATAATGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-967s1c1
Sequence:CCGGCCGGGCAGAGAAGAAGTTAAACTCGAGTTTAACTTCTTCTCTGCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014945
ABLIM3 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2357s21c1
Sequence:CCGGTCTACTGAAGCTCGGTATAATCTCGAGATTATACCGAGCTTCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014945.2-1126s21c1
Sequence:CCGGACCGAGTCATCTGCGCTAAAGCTCGAGCTTTAGCGCAGATGACTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014945.2-2681s21c1
Sequence:CCGGTGTGGTTTCCACACCTTATTGCTCGAGCAATAAGGTGTGGAAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1742s1c1
Sequence:CCGGCGGCTGATTCTGAAGGAAGAACTCGAGTTCTTCCTTCAGAATCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-597s1c1
Sequence:CCGGCCATCAAGATTCGTGGACCAACTCGAGTTGGTCCACGAATCTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014945.1-2362s1c1
Sequence:CCGGGCCCACGTCATCGAGATATTTCTCGAGAAATATCTCGATGACGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-1219s1c1
Sequence:CCGGGCTGGGAACATTATCTCCCTACTCGAGTAGGGAGATAATGTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014945.1-967s1c1
Sequence:CCGGCCGGGCAGAGAAGAAGTTAAACTCGAGTTTAACTTCTTCTCTGCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198649
ABLIM3 MISSION shRNA Bacterial Glycerol Stock
actin binding LIM protein family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198649.2-2669s1c1
Sequence:CCGGCGCAGTATAATCCTCTTGTATCTCGAGATACAAGAGGATTATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-896s1c1
Sequence:CCGGGCCTTTCCCTATTGGAGATAACTCGAGTTATCTCCAATAGGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-2564s1c1
Sequence:CCGGCTGGAAGAGGAACGAACTGAACTCGAGTTCAGTTCGTTCCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1379s1c1
Sequence:CCGGGCGGACATCTGAAACTTCCATCTCGAGATGGAAGTTTCAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1452s1c1
Sequence:CCGGGTGGATAATGAGATCCTTAATCTCGAGATTAAGGATCTCATTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198649
ABLIM3 MISSION shRNA shRNA Plasmid DNA
actin binding LIM protein family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198649.2-2669s1c1
Sequence:CCGGCGCAGTATAATCCTCTTGTATCTCGAGATACAAGAGGATTATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-896s1c1
Sequence:CCGGGCCTTTCCCTATTGGAGATAACTCGAGTTATCTCCAATAGGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-2564s1c1
Sequence:CCGGCTGGAAGAGGAACGAACTGAACTCGAGTTCAGTTCGTTCCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1379s1c1
Sequence:CCGGGCGGACATCTGAAACTTCCATCTCGAGATGGAAGTTTCAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1452s1c1
Sequence:CCGGGTGGATAATGAGATCCTTAATCTCGAGATTAAGGATCTCATTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198649
ABLIM3 MISSION shRNA Lentiviral Transduction Particles
actin binding LIM protein family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198649.2-2669s1c1
Sequence:CCGGCGCAGTATAATCCTCTTGTATCTCGAGATACAAGAGGATTATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-896s1c1
Sequence:CCGGGCCTTTCCCTATTGGAGATAACTCGAGTTATCTCCAATAGGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-2564s1c1
Sequence:CCGGCTGGAAGAGGAACGAACTGAACTCGAGTTCAGTTCGTTCCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1379s1c1
Sequence:CCGGGCGGACATCTGAAACTTCCATCTCGAGATGGAAGTTTCAGATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198649.2-1452s1c1
Sequence:CCGGGTGGATAATGAGATCCTTAATCTCGAGATTAAGGATCTCATTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks