EMAIL THIS PAGE TO A FRIEND

ABO

ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)

31 Gene Product Result for
Synonyms: A3GALNT A3GALT1 GTB NAGAT
Gene ID:
Human(28) Summary: This gene encodes proteins related to the first discovered blood group system, ABO. Which allele is present in an individual determines the blood group. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(80908) ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase)
Rat(100301568) ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Zebrafish(563897) ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
fruit fly(44793) abnormal oocyte
cow(515340) ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
dog(491265) ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151561 MISSION® esiRNA esiRNA human ABO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020469 Rosetta Predictions human pricing
NM_030718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082868 predicted 365
2 SASI_Hs01_00082869 predicted 248
3 SASI_Hs01_00082870 predicted 257
4 SASI_Hs01_00082871 predicted 371
5 SASI_Hs01_00082872 predicted 583
6 SASI_Hs01_00082873 predicted 300
7 SASI_Hs01_00082874 predicted 901
8 SASI_Hs01_00082875 predicted 952
9 SASI_Hs01_00082876 predicted 236
10 SASI_Hs01_00082877 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100548 predicted 540
2 SASI_Mm01_00100549 predicted 701
3 SASI_Mm01_00100550 predicted 592
4 SASI_Mm01_00100551 predicted 361
5 SASI_Mm01_00100552 predicted 1155
6 SASI_Mm01_00100553 predicted 596
7 SASI_Mm01_00100554 predicted 945
8 SASI_Mm01_00100555 predicted 1118
9 SASI_Mm01_00100556 predicted 537
10 SASI_Mm01_00100557 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020469
ABO MISSION shRNA Bacterial Glycerol Stock
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-364s1c1
Sequence:CCGGGCCATCAAGAAATACGTGGCTCTCGAGAGCCACGTATTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-564s1c1
Sequence:CCGGCATGGAGATGATCAGTGACTTCTCGAGAAGTCACTGATCATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-318s1c1
Sequence:CCGGCGAGCAGTTCAGGCTCCAGAACTCGAGTTCTGGAGCCTGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-47s1c1
Sequence:CCGGCACTTCGACCTATGATCCTTTCTCGAGAAAGGATCATAGGTCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020469.2-1156s21c1
Sequence:CCGGAGAACGGGTAAACTCTGTTTCCTCGAGGAAACAGAGTTTACCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020469.2-102s21c1
Sequence:CCGGTGCTTGTCTTGGTCTTGTTTGCTCGAGCAAACAAGACCAAGACAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020469
ABO MISSION shRNA shRNA Plasmid DNA
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-364s1c1
Sequence:CCGGGCCATCAAGAAATACGTGGCTCTCGAGAGCCACGTATTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-564s1c1
Sequence:CCGGCATGGAGATGATCAGTGACTTCTCGAGAAGTCACTGATCATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-318s1c1
Sequence:CCGGCGAGCAGTTCAGGCTCCAGAACTCGAGTTCTGGAGCCTGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-47s1c1
Sequence:CCGGCACTTCGACCTATGATCCTTTCTCGAGAAAGGATCATAGGTCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020469.2-1156s21c1
Sequence:CCGGAGAACGGGTAAACTCTGTTTCCTCGAGGAAACAGAGTTTACCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020469.2-102s21c1
Sequence:CCGGTGCTTGTCTTGGTCTTGTTTGCTCGAGCAAACAAGACCAAGACAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020469
ABO MISSION shRNA Lentiviral Transduction Particles
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-364s1c1
Sequence:CCGGGCCATCAAGAAATACGTGGCTCTCGAGAGCCACGTATTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-564s1c1
Sequence:CCGGCATGGAGATGATCAGTGACTTCTCGAGAAGTCACTGATCATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-318s1c1
Sequence:CCGGCGAGCAGTTCAGGCTCCAGAACTCGAGTTCTGGAGCCTGAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020469.1-47s1c1
Sequence:CCGGCACTTCGACCTATGATCCTTTCTCGAGAAAGGATCATAGGTCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020469.2-1156s21c1
Sequence:CCGGAGAACGGGTAAACTCTGTTTCCTCGAGGAAACAGAGTTTACCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020469.2-102s21c1
Sequence:CCGGTGCTTGTCTTGGTCTTGTTTGCTCGAGCAAACAAGACCAAGACAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030718
ABO MISSION shRNA Bacterial Glycerol Stock
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030718.2-1494s1c1
Sequence:CCGGGCCCATAACCTCTGCTCATTTCTCGAGAAATGAGCAGAGGTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-149s1c1
Sequence:CCGGCCCTTCGCAGTGTTTGTCTTACTCGAGTAAGACAAACACTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-934s1c1
Sequence:CCGGGCATGATGAGAGCTATTTGAACTCGAGTTCAAATAGCTCTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-325s1c1
Sequence:CCGGGAGGACCTTCAACATCGACATCTCGAGATGTCGATGTTGAAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-630s1c1
Sequence:CCGGGCTTTCTACGTGAGGTGGATTCTCGAGAATCCACCTCACGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030718
ABO MISSION shRNA shRNA Plasmid DNA
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030718.2-1494s1c1
Sequence:CCGGGCCCATAACCTCTGCTCATTTCTCGAGAAATGAGCAGAGGTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-149s1c1
Sequence:CCGGCCCTTCGCAGTGTTTGTCTTACTCGAGTAAGACAAACACTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-934s1c1
Sequence:CCGGGCATGATGAGAGCTATTTGAACTCGAGTTCAAATAGCTCTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-325s1c1
Sequence:CCGGGAGGACCTTCAACATCGACATCTCGAGATGTCGATGTTGAAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-630s1c1
Sequence:CCGGGCTTTCTACGTGAGGTGGATTCTCGAGAATCCACCTCACGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030718
ABO MISSION shRNA Lentiviral Transduction Particles
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030718.2-1494s1c1
Sequence:CCGGGCCCATAACCTCTGCTCATTTCTCGAGAAATGAGCAGAGGTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-149s1c1
Sequence:CCGGCCCTTCGCAGTGTTTGTCTTACTCGAGTAAGACAAACACTGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-934s1c1
Sequence:CCGGGCATGATGAGAGCTATTTGAACTCGAGTTCAAATAGCTCTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-325s1c1
Sequence:CCGGGAGGACCTTCAACATCGACATCTCGAGATGTCGATGTTGAAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030718.2-630s1c1
Sequence:CCGGGCTTTCTACGTGAGGTGGATTCTCGAGAATCCACCTCACGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks