EMAIL THIS PAGE TO A FRIEND

ABR

active BCR-related

162 Gene Product Result for
Synonyms: MDB
Gene ID:
Human(29) Summary: This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
Mouse(109934) active BCR-related gene
Rat(287537) active BCR-related
cow(515556) active BCR-related gene
Horse(100059804) active BCR-related
domestic cat(101089660) active BCR-related
dog(480638) active BCR-related
sheep(101112992) active BCR-related
Domestic Rabbit(100338932) active BCR-related
naked mole-rat(101709206) active BCR-related
domestic guinea pig(100716259) active BCR-related
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001092 Rosetta Predictions human pricing
NM_021962 Rosetta Predictions human pricing
NM_001105814 Rosetta Predictions rat pricing
NM_198018 Rosetta Predictions mouse pricing
NM_198894 Rosetta Predictions mouse pricing
NM_198895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102145 predicted 510
2 SASI_Hs01_00102146 predicted 1405
3 SASI_Hs01_00102147 predicted 1333
4 SASI_Hs01_00102148 predicted 2295
5 SASI_Hs01_00102149 predicted 1841
6 SASI_Hs01_00102150 predicted 1439
7 SASI_Hs02_00318089 predicted 1051
8 SASI_Hs01_00102151 predicted 460
9 SASI_Hs01_00102152 predicted 869
10 SASI_Hs01_00102153 predicted 1263
11 SASI_Hs01_00102154 predicted 2464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180777 predicted 712
2 SASI_Hs01_00180778 predicted 1604
3 SASI_Hs01_00180779 predicted 1540
4 SASI_Hs01_00180780 predicted 2502
5 SASI_Hs01_00180781 predicted 2045
6 SASI_Hs01_00180782 predicted 1649
7 SASI_Hs02_00355304 predicted 1255
8 SASI_Hs01_00180783 predicted 664
9 SASI_Hs01_00180784 predicted 1072
10 SASI_Hs01_00180785 predicted 1471
11 SASI_Hs01_00180786 predicted 2670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212796 predicted 1225
2 SASI_Rn02_00212797 predicted 272
3 SASI_Rn02_00212798 predicted 2551
4 SASI_Rn02_00212799 predicted 838
5 SASI_Rn02_00212800 predicted 1892
6 SASI_Rn02_00212801 predicted 1500
7 SASI_Rn02_00212802 predicted 1854
8 SASI_Rn02_00212803 predicted 1978
9 SASI_Rn02_00212804 predicted 2364
10 SASI_Rn02_00212805 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201051 predicted 2038
2 SASI_Mm01_00201052 predicted 2478
3 SASI_Mm01_00201053 predicted 615
4 SASI_Mm01_00201054 predicted 2831
5 SASI_Mm01_00201055 predicted 1785
6 SASI_Mm02_00350728 predicted 1948
7 SASI_Mm01_00201057 predicted 1103
8 SASI_Mm01_00201058 predicted 2632
9 SASI_Mm01_00201059 predicted 581
10 SASI_Mm02_00350729 predicted 2650
11 SASI_Mm01_00201050 predicted 1524
12 SASI_Mm01_00201056 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154935 predicted 1909
2 SASI_Mm01_00154936 predicted 2346
3 SASI_Mm01_00154937 predicted 490
4 SASI_Mm01_00154938 predicted 2711
5 SASI_Mm01_00154939 predicted 1653
6 SASI_Mm02_00351211 predicted 1821
7 SASI_Mm01_00154941 predicted 977
8 SASI_Mm01_00154942 predicted 2504
9 SASI_Mm01_00154943 predicted 461
10 SASI_Mm02_00351212 predicted 2528
11 SASI_Mm01_00154934 predicted 1388
12 SASI_Mm01_00154940 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092017 predicted 2031
2 SASI_Mm01_00092018 predicted 2468
3 SASI_Mm01_00092019 predicted 610
4 SASI_Mm01_00092020 predicted 2834
5 SASI_Mm01_00092021 predicted 1777
6 SASI_Mm02_00351213 predicted 1942
7 SASI_Mm01_00092023 predicted 1099
8 SASI_Mm01_00092024 predicted 2625
9 SASI_Mm01_00092025 predicted 577
10 SASI_Mm02_00351214 predicted 2648
11 SASI_Mm01_00092016 predicted 1512
12 SASI_Mm01_00092022 predicted 2145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001092
VALIDATED
ABR MISSION shRNA Bacterial Glycerol Stock
active BCR-related
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-2286s21c1
Sequence:CCGGACAACCTGGCTACCGTGTTTGCTCGAGCAAACACGGTAGCCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-1179s21c1
Sequence:CCGGTCCCGTTCAGGATCCACAATCCTCGAGGATTGTGGATCCTGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-313s1c1
Sequence:CCGGCGAGACCATCTTCTACAAGATCTCGAGATCTTGTAGAAGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1738s1c1
Sequence:CCGGCGTGATTGAGATGAACGGGATCTCGAGATCCCGTTCATCTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001092.3-461s1c1
Sequence:CCGGGCGTTTGTCGATAACTATAAACTCGAGTTTATAGTTATCGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1120s1c1
Sequence:CCGGGCGCCTGAAGAAGAAGATGTTCTCGAGAACATCTTCTTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1607s1c1
Sequence:CCGGCTGTGCTATGAGAAGTGCTATCTCGAGATAGCACTTCTCATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001092
VALIDATED
ABR MISSION shRNA shRNA Plasmid DNA
active BCR-related
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-2286s21c1
Sequence:CCGGACAACCTGGCTACCGTGTTTGCTCGAGCAAACACGGTAGCCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-1179s21c1
Sequence:CCGGTCCCGTTCAGGATCCACAATCCTCGAGGATTGTGGATCCTGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-313s1c1
Sequence:CCGGCGAGACCATCTTCTACAAGATCTCGAGATCTTGTAGAAGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1738s1c1
Sequence:CCGGCGTGATTGAGATGAACGGGATCTCGAGATCCCGTTCATCTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001092.3-461s1c1
Sequence:CCGGGCGTTTGTCGATAACTATAAACTCGAGTTTATAGTTATCGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1120s1c1
Sequence:CCGGGCGCCTGAAGAAGAAGATGTTCTCGAGAACATCTTCTTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1607s1c1
Sequence:CCGGCTGTGCTATGAGAAGTGCTATCTCGAGATAGCACTTCTCATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001092
VALIDATED
ABR MISSION shRNA Lentiviral Transduction Particles
active BCR-related
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-2286s21c1
Sequence:CCGGACAACCTGGCTACCGTGTTTGCTCGAGCAAACACGGTAGCCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001092.3-1179s21c1
Sequence:CCGGTCCCGTTCAGGATCCACAATCCTCGAGGATTGTGGATCCTGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-313s1c1
Sequence:CCGGCGAGACCATCTTCTACAAGATCTCGAGATCTTGTAGAAGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1738s1c1
Sequence:CCGGCGTGATTGAGATGAACGGGATCTCGAGATCCCGTTCATCTCAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001092.3-461s1c1
Sequence:CCGGGCGTTTGTCGATAACTATAAACTCGAGTTTATAGTTATCGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1120s1c1
Sequence:CCGGGCGCCTGAAGAAGAAGATGTTCTCGAGAACATCTTCTTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001092.3-1607s1c1
Sequence:CCGGCTGTGCTATGAGAAGTGCTATCTCGAGATAGCACTTCTCATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198894
VALIDATED
ABR MISSION shRNA Bacterial Glycerol Stock
active BCR-related
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2704s21c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2579s21c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2519s21c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3043s21c1
Sequence:CCGGGGTATGGGCACAGACAGATTGCTCGAGCAATCTGTCTGTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-860s21c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3077s21c1
Sequence:CCGGTTTCTCCCAGCACTCACTTTCCTCGAGGAAAGTGAGTGCTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-4294s1c1
Sequence:CCGGGCTAAGTCTAAACAAGGGTTTCTCGAGAAACCCTTGTTTAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-860s1c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2519s1c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2579s1c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2704s1c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198894
VALIDATED
ABR MISSION shRNA shRNA Plasmid DNA
active BCR-related
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2704s21c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2579s21c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2519s21c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3043s21c1
Sequence:CCGGGGTATGGGCACAGACAGATTGCTCGAGCAATCTGTCTGTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-860s21c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3077s21c1
Sequence:CCGGTTTCTCCCAGCACTCACTTTCCTCGAGGAAAGTGAGTGCTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-4294s1c1
Sequence:CCGGGCTAAGTCTAAACAAGGGTTTCTCGAGAAACCCTTGTTTAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-860s1c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2519s1c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2579s1c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2704s1c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198894
VALIDATED
ABR MISSION shRNA Lentiviral Transduction Particles
active BCR-related
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2704s21c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2579s21c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-2519s21c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3043s21c1
Sequence:CCGGGGTATGGGCACAGACAGATTGCTCGAGCAATCTGTCTGTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198894.1-860s21c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198894.1-3077s21c1
Sequence:CCGGTTTCTCCCAGCACTCACTTTCCTCGAGGAAAGTGAGTGCTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-4294s1c1
Sequence:CCGGGCTAAGTCTAAACAAGGGTTTCTCGAGAAACCCTTGTTTAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-860s1c1
Sequence:CCGGGCTCTGCTGTACAAGCCAATTCTCGAGAATTGGCTTGTACAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2519s1c1
Sequence:CCGGCCCATCAACAAGATGTCACTTCTCGAGAAGTGACATCTTGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2579s1c1
Sequence:CCGGCCATCAGAAGTGGAGAGCAAACTCGAGTTTGCTCTCCACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198894.1-2704s1c1
Sequence:CCGGGAAGCGGAACACACTGTACTTCTCGAGAAGTACAGTGTGTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks