EMAIL THIS PAGE TO A FRIEND

ABRA

actin-binding Rho activating protein

50 Gene Product Result for
Synonyms: STARS
UniProtKB ID: Q8N0Z2
Gene ID:
Mouse(223513) actin-binding Rho activating protein
Rat(286965) actin-binding Rho activating protein
chicken(430953) actin-binding Rho activating protein
dog(481999) actin-binding Rho activating protein
cow(539379) actin-binding Rho activating protein
Horse(100056433) actin-binding Rho activating protein
domestic cat(101086626) actin-binding Rho activating protein
domestic guinea pig(100728944) actin-binding Rho activating protein
naked mole-rat(101703602) actin-binding Rho activating protein
sheep(101123385) actin-binding Rho activating protein
Domestic Rabbit(100345925) actin-binding Rho activating protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139166 Rosetta Predictions human pricing
NM_175844 Rosetta Predictions rat pricing
NM_175456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156931 predicted 1072
2 SASI_Hs01_00156933 predicted 544
3 SASI_Hs01_00156934 predicted 1027
4 SASI_Hs01_00156935 predicted 385
5 SASI_Hs02_00364189 predicted 224
6 SASI_Hs01_00156936 predicted 986
7 SASI_Hs01_00156938 predicted 591
8 SASI_Hs02_00364190 predicted 984
9 SASI_Hs01_00156939 predicted 1055
10 SASI_Hs02_00364191 predicted 535
11 SASI_Hs01_00156932 predicted 223
12 SASI_Hs01_00156937 predicted 758
13 SASI_Hs01_00156940 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056258 predicted 950
2 SASI_Rn01_00056259 predicted 363
3 SASI_Rn01_00056260 predicted 1007
4 SASI_Rn01_00056261 predicted 516
5 SASI_Rn01_00056262 predicted 707
6 SASI_Rn02_00269548 predicted 1063
7 SASI_Rn01_00056265 predicted 222
8 SASI_Rn01_00056266 predicted 875
9 SASI_Rn02_00269549 predicted 587
10 SASI_Rn01_00056267 predicted 478
11 SASI_Rn01_00056263 predicted 950
12 SASI_Rn01_00056264 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182197 predicted 1220
2 SASI_Mm01_00182198 predicted 1198
3 SASI_Mm01_00182199 predicted 1013
4 SASI_Mm02_00346360 predicted 968
5 SASI_Mm01_00182200 predicted 723
6 SASI_Mm01_00182202 predicted 949
7 SASI_Mm01_00182203 predicted 1025
8 SASI_Mm01_00182204 predicted 1122
9 SASI_Mm01_00182205 predicted 477
10 SASI_Mm01_00182206 predicted 1037
11 SASI_Mm01_00182201 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139166
ABRA MISSION shRNA Bacterial Glycerol Stock
actin-binding Rho activating protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-718s1c1
Sequence:CCGGCCTCCCAGGTAAACAGATTTACTCGAGTAAATCTGTTTACCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1064s1c1
Sequence:CCGGCTTTGACAGATACGTTCGTATCTCGAGATACGAACGTATCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-351s1c1
Sequence:CCGGCCTGAGGTTTCTCACATCAAACTCGAGTTTGATGTGAGAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-968s1c1
Sequence:CCGGGCACATCTACAGGGAAATGATCTCGAGATCATTTCCCTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1168s1c1
Sequence:CCGGGAGATGACCATGTTGTGATTACTCGAGTAATCACAACATGGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-824s21c1
Sequence:CCGGTACAATCCCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGGGATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-484s21c1
Sequence:CCGGGAGAATGACATTGACAGAATCCTCGAGGATTCTGTCAATGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1246s21c1
Sequence:CCGGCTAAATGCTCATGTAGGTAAACTCGAGTTTACCTACATGAGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1323s21c1
Sequence:CCGGACGACTTTCTGGCATTCTATTCTCGAGAATAGAATGCCAGAAAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139166
ABRA MISSION shRNA shRNA Plasmid DNA
actin-binding Rho activating protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-718s1c1
Sequence:CCGGCCTCCCAGGTAAACAGATTTACTCGAGTAAATCTGTTTACCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1064s1c1
Sequence:CCGGCTTTGACAGATACGTTCGTATCTCGAGATACGAACGTATCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-351s1c1
Sequence:CCGGCCTGAGGTTTCTCACATCAAACTCGAGTTTGATGTGAGAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-968s1c1
Sequence:CCGGGCACATCTACAGGGAAATGATCTCGAGATCATTTCCCTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1168s1c1
Sequence:CCGGGAGATGACCATGTTGTGATTACTCGAGTAATCACAACATGGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-824s21c1
Sequence:CCGGTACAATCCCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGGGATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-484s21c1
Sequence:CCGGGAGAATGACATTGACAGAATCCTCGAGGATTCTGTCAATGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1246s21c1
Sequence:CCGGCTAAATGCTCATGTAGGTAAACTCGAGTTTACCTACATGAGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1323s21c1
Sequence:CCGGACGACTTTCTGGCATTCTATTCTCGAGAATAGAATGCCAGAAAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139166
ABRA MISSION shRNA Lentiviral Transduction Particles
actin-binding Rho activating protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-718s1c1
Sequence:CCGGCCTCCCAGGTAAACAGATTTACTCGAGTAAATCTGTTTACCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1064s1c1
Sequence:CCGGCTTTGACAGATACGTTCGTATCTCGAGATACGAACGTATCTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-351s1c1
Sequence:CCGGCCTGAGGTTTCTCACATCAAACTCGAGTTTGATGTGAGAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-968s1c1
Sequence:CCGGGCACATCTACAGGGAAATGATCTCGAGATCATTTCCCTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139166.2-1168s1c1
Sequence:CCGGGAGATGACCATGTTGTGATTACTCGAGTAATCACAACATGGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-824s21c1
Sequence:CCGGTACAATCCCAGAAGCTCAATCCTCGAGGATTGAGCTTCTGGGATTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139166.4-484s21c1
Sequence:CCGGGAGAATGACATTGACAGAATCCTCGAGGATTCTGTCAATGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1246s21c1
Sequence:CCGGCTAAATGCTCATGTAGGTAAACTCGAGTTTACCTACATGAGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139166.4-1323s21c1
Sequence:CCGGACGACTTTCTGGCATTCTATTCTCGAGAATAGAATGCCAGAAAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175456
ABRA MISSION shRNA Bacterial Glycerol Stock
actin-binding Rho activating protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.2-1146s1c1
Sequence:CCGGCGAGACGACCATGTTGTGATTCTCGAGAATCACAACATGGTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1244s1c1
Sequence:CCGGCTCTGCAATGTTATCAATATTCTCGAGAATATTGATAACATTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1590s1c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.4-117s1c1
Sequence:CCGGCAGCAACCCTGGTTATCAATTCTCGAGAATTGATAACCAGGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1173s21c1
Sequence:CCGGTTGAGTAAGCCCGCAACAAATCTCGAGATTTGTTGCGGGCTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-730s21c1
Sequence:CCGGCTGTAAGGCCCATCGGAAATACTCGAGTATTTCCGATGGGCCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-944s21c1
Sequence:CCGGGAGCACATCTATCGGGAAATTCTCGAGAATTTCCCGATAGATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175456.4-1590s21c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1045s21c1
Sequence:CCGGTGATCGCTATGTTCGAATTTCCTCGAGGAAATTCGAACATAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175456
ABRA MISSION shRNA shRNA Plasmid DNA
actin-binding Rho activating protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.2-1146s1c1
Sequence:CCGGCGAGACGACCATGTTGTGATTCTCGAGAATCACAACATGGTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1244s1c1
Sequence:CCGGCTCTGCAATGTTATCAATATTCTCGAGAATATTGATAACATTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1590s1c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.4-117s1c1
Sequence:CCGGCAGCAACCCTGGTTATCAATTCTCGAGAATTGATAACCAGGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1173s21c1
Sequence:CCGGTTGAGTAAGCCCGCAACAAATCTCGAGATTTGTTGCGGGCTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-730s21c1
Sequence:CCGGCTGTAAGGCCCATCGGAAATACTCGAGTATTTCCGATGGGCCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-944s21c1
Sequence:CCGGGAGCACATCTATCGGGAAATTCTCGAGAATTTCCCGATAGATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175456.4-1590s21c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1045s21c1
Sequence:CCGGTGATCGCTATGTTCGAATTTCCTCGAGGAAATTCGAACATAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175456
ABRA MISSION shRNA Lentiviral Transduction Particles
actin-binding Rho activating protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.2-1146s1c1
Sequence:CCGGCGAGACGACCATGTTGTGATTCTCGAGAATCACAACATGGTCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1244s1c1
Sequence:CCGGCTCTGCAATGTTATCAATATTCTCGAGAATATTGATAACATTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175456.4-1590s1c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175456.4-117s1c1
Sequence:CCGGCAGCAACCCTGGTTATCAATTCTCGAGAATTGATAACCAGGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1173s21c1
Sequence:CCGGTTGAGTAAGCCCGCAACAAATCTCGAGATTTGTTGCGGGCTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-730s21c1
Sequence:CCGGCTGTAAGGCCCATCGGAAATACTCGAGTATTTCCGATGGGCCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-944s21c1
Sequence:CCGGGAGCACATCTATCGGGAAATTCTCGAGAATTTCCCGATAGATGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175456.4-1590s21c1
Sequence:CCGGGAATGGCCTCCAACTCTATTTCTCGAGAAATAGAGTTGGAGGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175456.4-1045s21c1
Sequence:CCGGTGATCGCTATGTTCGAATTTCCTCGAGGAAATTCGAACATAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks