EMAIL THIS PAGE TO A FRIEND

ABRACL

ABRA C-terminal like

79 Gene Product Result for
Synonyms: C6orf115 Costars HSPC280 PRO2013
UniProtKB ID: Q9P1F3, Q5SZC8, Q9P0A1
Gene ID:
Mouse(73112) ABRA C-terminal like
Rat(685045) ABRA C-terminal like
Zebrafish(336650) ABRA C-terminal like
cow(505914) ABRA C-terminal like
domestic cat(101085546) ABRA C-terminal like
dog(476222) ABRA C-terminal like
sheep(101115375) ABRA C-terminal like
naked mole-rat(101700636) ABRA C-terminal like
domestic guinea pig(100719398) ABRA C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021243 Rosetta Predictions human pricing
XM_371848 Rosetta Predictions human pricing
NM_001099647 Rosetta Predictions rat pricing
NM_028440 Rosetta Predictions mouse pricing
XM_125510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354894 predicted 222
2 SASI_Hs02_00354895 predicted 327
3 SASI_Hs02_00354896 predicted 482
4 SASI_Hs02_00354897 predicted 233
5 SASI_Hs02_00354898 predicted 257
6 SASI_Hs02_00354899 predicted 509
7 SASI_Hs02_00354900 predicted 309
8 SASI_Hs02_00354901 predicted 419
9 SASI_Hs02_00354902 predicted 506
10 SASI_Hs02_00354903 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268274 predicted 549
2 SASI_Hs01_00268275 predicted 618
3 SASI_Hs01_00268276 predicted 617
4 SASI_Hs01_00268277 predicted 571
5 SASI_Hs01_00268278 predicted 562
6 SASI_Hs01_00268279 predicted 570
7 SASI_Hs01_00268280 predicted 652
8 SASI_Hs01_00268281 predicted 564
9 SASI_Hs01_00268282 predicted 636
10 SASI_Hs01_00268283 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209695 predicted 256
2 SASI_Rn02_00209696 predicted 216
3 SASI_Rn02_00209697 predicted 226
4 SASI_Rn02_00209698 predicted 257
5 SASI_Rn02_00209699 predicted 237
6 SASI_Rn02_00209700 predicted 356
7 SASI_Rn02_00209701 predicted 278
8 SASI_Rn02_00209702 predicted 332
9 SASI_Rn02_00209703 predicted 326
10 SASI_Rn02_00209704 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333872 predicted 442
2 SASI_Mm02_00333873 predicted 408
3 SASI_Mm02_00333874 predicted 303
4 SASI_Mm02_00333875 predicted 536
5 SASI_Mm02_00333876 predicted 417
6 SASI_Mm02_00333877 predicted 482
7 SASI_Mm02_00333878 predicted 496
8 SASI_Mm02_00333879 predicted 463
9 SASI_Mm02_00333880 predicted 300
10 SASI_Mm02_00333881 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209320 predicted 597
2 SASI_Mm01_00209321 predicted 617
3 SASI_Mm01_00209322 predicted 598
4 SASI_Mm01_00209323 predicted 626
5 SASI_Mm01_00209324 predicted 673
6 SASI_Mm01_00209325 predicted 615
7 SASI_Mm01_00209326 predicted 624
8 SASI_Mm01_00209327 predicted 590
9 SASI_Mm01_00209328 predicted 594
10 SASI_Mm01_00209329 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028440
VALIDATED
ABRACL MISSION shRNA Bacterial Glycerol Stock
ABRA C-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-419s21c1
Sequence:CCGGTTGTATTGCTGCAAGATTAATCTCGAGATTAATCTTGCAGCAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-496s21c1
Sequence:CCGGACGTGAATTTCCTTATGTATTCTCGAGAATACATAAGGAAATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-232s21c1
Sequence:CCGGATTCATCGCCTGGGTTCCAGACTCGAGTCTGGAACCCAGGCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028440.1-618s21c1
Sequence:CCGGTCTTAAGAAGGTAATTGGGAACTCGAGTTCCCAATTACCTTCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-629s21c1
Sequence:CCGGTAATTGGGAAATGTAGGTAATCTCGAGATTACCTACATTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028440
VALIDATED
ABRACL MISSION shRNA shRNA Plasmid DNA
ABRA C-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-419s21c1
Sequence:CCGGTTGTATTGCTGCAAGATTAATCTCGAGATTAATCTTGCAGCAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-496s21c1
Sequence:CCGGACGTGAATTTCCTTATGTATTCTCGAGAATACATAAGGAAATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-232s21c1
Sequence:CCGGATTCATCGCCTGGGTTCCAGACTCGAGTCTGGAACCCAGGCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028440.1-618s21c1
Sequence:CCGGTCTTAAGAAGGTAATTGGGAACTCGAGTTCCCAATTACCTTCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-629s21c1
Sequence:CCGGTAATTGGGAAATGTAGGTAATCTCGAGATTACCTACATTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028440
VALIDATED
ABRACL MISSION shRNA Lentiviral Transduction Particles
ABRA C-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-419s21c1
Sequence:CCGGTTGTATTGCTGCAAGATTAATCTCGAGATTAATCTTGCAGCAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-496s21c1
Sequence:CCGGACGTGAATTTCCTTATGTATTCTCGAGAATACATAAGGAAATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-232s21c1
Sequence:CCGGATTCATCGCCTGGGTTCCAGACTCGAGTCTGGAACCCAGGCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028440.1-618s21c1
Sequence:CCGGTCTTAAGAAGGTAATTGGGAACTCGAGTTCCCAATTACCTTCTTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028440.1-629s21c1
Sequence:CCGGTAATTGGGAAATGTAGGTAATCTCGAGATTACCTACATTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021243
VALIDATED
ABRACL MISSION shRNA Bacterial Glycerol Stock
ABRA C-terminal like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-295s21c1
Sequence:CCGGTCCTCTTCCGTGATGATAAATCTCGAGATTTATCATCACGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-268s21c1
Sequence:CCGGATGGAAAGTTAAGCGTGAAATCTCGAGATTTCACGCTTAACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-333s21c1
Sequence:CCGGGCATTGGTAGGAACTCTTAAACTCGAGTTTAAGAGTTCCTACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-484s21c1
Sequence:CCGGTTCTGGTAAACTGGAATATAACTCGAGTTATATTCCAGTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-436s21c1
Sequence:CCGGTGCAAGATTAATGTGGTTTACCTCGAGGTAAACCACATTAATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021243
VALIDATED
ABRACL MISSION shRNA shRNA Plasmid DNA
ABRA C-terminal like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-295s21c1
Sequence:CCGGTCCTCTTCCGTGATGATAAATCTCGAGATTTATCATCACGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-268s21c1
Sequence:CCGGATGGAAAGTTAAGCGTGAAATCTCGAGATTTCACGCTTAACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-333s21c1
Sequence:CCGGGCATTGGTAGGAACTCTTAAACTCGAGTTTAAGAGTTCCTACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-484s21c1
Sequence:CCGGTTCTGGTAAACTGGAATATAACTCGAGTTATATTCCAGTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-436s21c1
Sequence:CCGGTGCAAGATTAATGTGGTTTACCTCGAGGTAAACCACATTAATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021243
VALIDATED
ABRACL MISSION shRNA Lentiviral Transduction Particles
ABRA C-terminal like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-295s21c1
Sequence:CCGGTCCTCTTCCGTGATGATAAATCTCGAGATTTATCATCACGGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-268s21c1
Sequence:CCGGATGGAAAGTTAAGCGTGAAATCTCGAGATTTCACGCTTAACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-333s21c1
Sequence:CCGGGCATTGGTAGGAACTCTTAAACTCGAGTTTAAGAGTTCCTACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-484s21c1
Sequence:CCGGTTCTGGTAAACTGGAATATAACTCGAGTTATATTCCAGTTTACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021243.2-436s21c1
Sequence:CCGGTGCAAGATTAATGTGGTTTACCTCGAGGTAAACCACATTAATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks