EMAIL THIS PAGE TO A FRIEND

ABT1

activator of basal transcription 1

Synonyms: hABT1
UniProtKB ID: Q9ULW3
Gene ID:
Human(29777) Summary: Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Mouse(30946) activator of basal transcription 1
Rat(306960) activator of basal transcription 1
Zebrafish(553568) activator of basal transcription 1
cow(539270) activator of basal transcription 1
domestic cat(101086227) activator of basal transcription 1
dog(488284) activator of basal transcription 1
domestic guinea pig(100713553) activator of basal transcription 1
sheep(101107052) activator of basal transcription 1
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013375 Rosetta Predictions human pricing
NM_001025674 Rosetta Predictions rat pricing
NM_013924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045878 predicted 1038
2 SASI_Hs01_00045879 predicted 684
3 SASI_Hs01_00045880 predicted 1042
4 SASI_Hs01_00045881 predicted 916
5 SASI_Hs01_00045882 predicted 750
6 SASI_Hs02_00344723 predicted 666
7 SASI_Hs01_00045883 predicted 213
8 SASI_Hs01_00045884 predicted 964
9 SASI_Hs01_00045885 predicted 569
10 SASI_Hs01_00045886 predicted 1075
11 SASI_Hs01_00045887 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203266 predicted 665
2 SASI_Rn02_00203267 predicted 594
3 SASI_Rn02_00203268 predicted 1009
4 SASI_Rn02_00203269 predicted 568
5 SASI_Rn02_00203270 predicted 955
6 SASI_Rn02_00203271 predicted 516
7 SASI_Rn02_00203272 predicted 411
8 SASI_Rn02_00203273 predicted 928
9 SASI_Rn02_00203274 predicted 549
10 SASI_Rn02_00203275 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172565 predicted 330
2 SASI_Mm01_00172566 predicted 1315
3 SASI_Mm01_00172567 predicted 1210
4 SASI_Mm01_00172568 predicted 736
5 SASI_Mm01_00172569 predicted 689
6 SASI_Mm01_00172570 predicted 585
7 SASI_Mm01_00172571 predicted 379
8 SASI_Mm01_00172572 predicted 276
9 SASI_Mm01_00172573 predicted 533
10 SASI_Mm01_00172574 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013924
VALIDATED
ABT1 MISSION shRNA Bacterial Glycerol Stock
activator of basal transcription 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-283s21c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-466s21c1
Sequence:CCGGCCTGTGGAACCTCAAGTATTTCTCGAGAAATACTTGAGGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-339s21c1
Sequence:CCGGCTAAGTACAGCAAGGACTATACTCGAGTATAGTCCTTGCTGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-786s21c1
Sequence:CCGGGGCTCCTTGCCAAGATCTTTGCTCGAGCAAAGATCTTGGCAAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013924.3-1227s21c1
Sequence:CCGGGGTCCAATTTGAGGCTTATATCTCGAGATATAAGCCTCAAATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013924.1-3781s1c1
Sequence:CCGGCCCAATTAGAAGTTGTCCTTTCTCGAGAAAGGACAACTTCTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013924.1-284s1c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-656s1c1
Sequence:CCGGGCCAAATAGCTCCTGGACATTCTCGAGAATGTCCAGGAGCTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-603s1c1
Sequence:CCGGCGAAACGTAGAACAGGGACAACTCGAGTTGTCCCTGTTCTACGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-413s1c1
Sequence:CCGGCAGTCTACATAACACGCCCATCTCGAGATGGGCGTGTTATGTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013924
VALIDATED
ABT1 MISSION shRNA shRNA Plasmid DNA
activator of basal transcription 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-283s21c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-466s21c1
Sequence:CCGGCCTGTGGAACCTCAAGTATTTCTCGAGAAATACTTGAGGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-339s21c1
Sequence:CCGGCTAAGTACAGCAAGGACTATACTCGAGTATAGTCCTTGCTGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-786s21c1
Sequence:CCGGGGCTCCTTGCCAAGATCTTTGCTCGAGCAAAGATCTTGGCAAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013924.3-1227s21c1
Sequence:CCGGGGTCCAATTTGAGGCTTATATCTCGAGATATAAGCCTCAAATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013924.1-3781s1c1
Sequence:CCGGCCCAATTAGAAGTTGTCCTTTCTCGAGAAAGGACAACTTCTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013924.1-284s1c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-656s1c1
Sequence:CCGGGCCAAATAGCTCCTGGACATTCTCGAGAATGTCCAGGAGCTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-603s1c1
Sequence:CCGGCGAAACGTAGAACAGGGACAACTCGAGTTGTCCCTGTTCTACGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-413s1c1
Sequence:CCGGCAGTCTACATAACACGCCCATCTCGAGATGGGCGTGTTATGTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013924
VALIDATED
ABT1 MISSION shRNA Lentiviral Transduction Particles
activator of basal transcription 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-283s21c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-466s21c1
Sequence:CCGGCCTGTGGAACCTCAAGTATTTCTCGAGAAATACTTGAGGTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-339s21c1
Sequence:CCGGCTAAGTACAGCAAGGACTATACTCGAGTATAGTCCTTGCTGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013924.3-786s21c1
Sequence:CCGGGGCTCCTTGCCAAGATCTTTGCTCGAGCAAAGATCTTGGCAAGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013924.3-1227s21c1
Sequence:CCGGGGTCCAATTTGAGGCTTATATCTCGAGATATAAGCCTCAAATTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013924.1-3781s1c1
Sequence:CCGGCCCAATTAGAAGTTGTCCTTTCTCGAGAAAGGACAACTTCTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013924.1-284s1c1
Sequence:CCGGCCACTTTGTGAAACGCAAGAACTCGAGTTCTTGCGTTTCACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-656s1c1
Sequence:CCGGGCCAAATAGCTCCTGGACATTCTCGAGAATGTCCAGGAGCTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-603s1c1
Sequence:CCGGCGAAACGTAGAACAGGGACAACTCGAGTTGTCCCTGTTCTACGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013924.1-413s1c1
Sequence:CCGGCAGTCTACATAACACGCCCATCTCGAGATGGGCGTGTTATGTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013375
VALIDATED
ABT1 MISSION shRNA Bacterial Glycerol Stock
activator of basal transcription 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013375.2-1052s21c1
Sequence:CCGGATACTGTCATACTAGCATAATCTCGAGATTATGCTAGTATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-170s21c1
Sequence:CCGGATTGTGTACCTGGGCCATATCCTCGAGGATATGGCCCAGGTACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-325s21c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-572s21c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-274s21c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-325s1c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-442s1c1
Sequence:CCGGCTTCCGTTATGATCTTTGGAACTCGAGTTCCAAAGATCATAACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-274s1c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-400s1c1
Sequence:CCGGCAGTCTACACAACACGCCTATCTCGAGATAGGCGTGTTGTGTAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-572s1c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013375
VALIDATED
ABT1 MISSION shRNA shRNA Plasmid DNA
activator of basal transcription 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013375.2-1052s21c1
Sequence:CCGGATACTGTCATACTAGCATAATCTCGAGATTATGCTAGTATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-170s21c1
Sequence:CCGGATTGTGTACCTGGGCCATATCCTCGAGGATATGGCCCAGGTACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-325s21c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-572s21c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-274s21c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-325s1c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-442s1c1
Sequence:CCGGCTTCCGTTATGATCTTTGGAACTCGAGTTCCAAAGATCATAACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-274s1c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-400s1c1
Sequence:CCGGCAGTCTACACAACACGCCTATCTCGAGATAGGCGTGTTGTGTAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-572s1c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013375
VALIDATED
ABT1 MISSION shRNA Lentiviral Transduction Particles
activator of basal transcription 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013375.2-1052s21c1
Sequence:CCGGATACTGTCATACTAGCATAATCTCGAGATTATGCTAGTATGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-170s21c1
Sequence:CCGGATTGTGTACCTGGGCCATATCCTCGAGGATATGGCCCAGGTACACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-325s21c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-572s21c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013375.2-274s21c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-325s1c1
Sequence:CCGGGCGGTCCTACACCAAGGACTACTCGAGTAGTCCTTGGTGTAGGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-442s1c1
Sequence:CCGGCTTCCGTTATGATCTTTGGAACTCGAGTTCCAAAGATCATAACGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-274s1c1
Sequence:CCGGCCGGTTCGTGAGACGCAAGAACTCGAGTTCTTGCGTCTCACGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013375.2-400s1c1
Sequence:CCGGCAGTCTACACAACACGCCTATCTCGAGATAGGCGTGTTGTGTAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013375.2-572s1c1
Sequence:CCGGGAGACCGACTTCTATCTTCAACTCGAGTTGAAGATAGAAGTCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks