EMAIL THIS PAGE TO A FRIEND

ABTB1

ankyrin repeat and BTB (POZ) domain containing 1

Synonyms: BPOZ BTB3 BTBD21 EF1ABP
UniProtKB ID: Q969K4, D3DNB0, Q6ZNU9, Q71MF1, Q96S62, Q96S63
Gene ID:
Human(80325) Summary: This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010]
Mouse(80283) ankyrin repeat and BTB (POZ) domain containing 1
Rat(297432) ankyrin repeat and BTB (POZ) domain containing 1
chicken(416026) ankyrin repeat and BTB (POZ) domain containing 1
cow(507417) ankyrin repeat and BTB (POZ) domain containing 1
Horse(100049815) ankyrin repeat and BTB (POZ) domain containing 1
domestic cat(101092092) ankyrin repeat and BTB (POZ) domain containing 1
dog(609299) ankyrin repeat and BTB (POZ) domain containing 1
sheep(101115578) ankyrin repeat and BTB (POZ) domain containing 1
naked mole-rat(101706896) ankyrin repeat and BTB (POZ) domain containing 1
domestic guinea pig(100720193) ankyrin repeat and BTB (POZ) domain containing 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032548 Rosetta Predictions human pricing
NM_172027 Rosetta Predictions human pricing
NM_172028 Rosetta Predictions human pricing
NM_001005902 Rosetta Predictions rat pricing
NM_030251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158684 predicted 738
2 SASI_Hs01_00158685 predicted 713
3 SASI_Hs01_00158686 predicted 542
4 SASI_Hs01_00158687 predicted 522
5 SASI_Hs01_00158688 predicted 725
6 SASI_Hs01_00158689 predicted 1572
7 SASI_Hs01_00158690 predicted 1136
8 SASI_Hs01_00158691 predicted 1066
9 SASI_Hs01_00158692 predicted 1494
10 SASI_Hs01_00158693 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112244 predicted 1549
2 SASI_Hs01_00112245 predicted 708
3 SASI_Hs01_00112246 predicted 744
4 SASI_Hs01_00112247 predicted 428
5 SASI_Hs01_00112248 predicted 427
6 SASI_Hs01_00112249 predicted 1073
7 SASI_Hs01_00112250 predicted 718
8 SASI_Hs01_00112251 predicted 717
9 SASI_Hs01_00112252 predicted 1565
10 SASI_Hs01_00112253 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025867 predicted 1519
2 SASI_Hs01_00025868 predicted 675
3 SASI_Hs01_00025869 predicted 716
4 SASI_Hs01_00025870 predicted 393
5 SASI_Hs01_00025871 predicted 389
6 SASI_Hs01_00025872 predicted 1044
7 SASI_Hs01_00025873 predicted 681
8 SASI_Hs01_00025874 predicted 682
9 SASI_Hs01_00025875 predicted 1534
10 SASI_Hs01_00025876 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109604 predicted 1017
2 SASI_Rn01_00109605 predicted 487
3 SASI_Rn01_00109607 predicted 601
4 SASI_Rn01_00109608 predicted 506
5 SASI_Rn01_00109609 predicted 1109
6 SASI_Rn01_00109610 predicted 349
7 SASI_Rn01_00109611 predicted 1055
8 SASI_Rn02_00198487 predicted 616
9 SASI_Rn01_00109612 predicted 566
10 SASI_Rn02_00198488 predicted 869
11 SASI_Rn01_00109606 predicted 856
12 SASI_Rn01_00109613 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170713 predicted 1096
2 SASI_Mm01_00170714 predicted 1310
3 SASI_Mm02_00336718 predicted 1635
4 SASI_Mm01_00170716 predicted 555
5 SASI_Mm01_00170717 predicted 1161
6 SASI_Mm01_00170719 predicted 401
7 SASI_Mm01_00170720 predicted 1506
8 SASI_Mm01_00170721 predicted 516
9 SASI_Mm01_00170722 predicted 748
10 SASI_Mm02_00336719 predicted 1154
11 SASI_Mm01_00170715 predicted 237
12 SASI_Mm01_00170718 predicted 1466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172027
ABTB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and BTB (POZ) domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-510s1c1
Sequence:CCGGCCAACATGCTGGACACCAAATCTCGAGATTTGGTGTCCAGCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172027.1-1568s1c1
Sequence:CCGGGACAAGCATGTGTATGCGTTTCTCGAGAAACGCATACACATGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-428s1c1
Sequence:CCGGCACAGTGACGTGGTCTTTGTACTCGAGTACAAAGACCACGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-632s1c1
Sequence:CCGGGTAGAGCATGTGAGTGACTGTCTCGAGACAGTCACTCACATGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-379s1c1
Sequence:CCGGGCGGGATTACTATGACGACTTCTCGAGAAGTCGTCATAGTAATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1075s1c1
Sequence:CCGGCTTCACTCACGTGCTCTACTACTCGAGTAGTAGAGCACGTGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-514s1c1
Sequence:CCGGCATGCTGGACACCAAATGGAACTCGAGTTCCATTTGGTGTCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1297s1c1
Sequence:CCGGCATGGCCAAGGTCATTGAGAACTCGAGTTCTCAATGACCTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-1303s1c1
Sequence:CCGGCAAGGTCATTGAGAAGCTGGTCTCGAGACCAGCTTCTCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172027
ABTB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and BTB (POZ) domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-510s1c1
Sequence:CCGGCCAACATGCTGGACACCAAATCTCGAGATTTGGTGTCCAGCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172027.1-1568s1c1
Sequence:CCGGGACAAGCATGTGTATGCGTTTCTCGAGAAACGCATACACATGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-428s1c1
Sequence:CCGGCACAGTGACGTGGTCTTTGTACTCGAGTACAAAGACCACGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-632s1c1
Sequence:CCGGGTAGAGCATGTGAGTGACTGTCTCGAGACAGTCACTCACATGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-379s1c1
Sequence:CCGGGCGGGATTACTATGACGACTTCTCGAGAAGTCGTCATAGTAATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1075s1c1
Sequence:CCGGCTTCACTCACGTGCTCTACTACTCGAGTAGTAGAGCACGTGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-514s1c1
Sequence:CCGGCATGCTGGACACCAAATGGAACTCGAGTTCCATTTGGTGTCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1297s1c1
Sequence:CCGGCATGGCCAAGGTCATTGAGAACTCGAGTTCTCAATGACCTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-1303s1c1
Sequence:CCGGCAAGGTCATTGAGAAGCTGGTCTCGAGACCAGCTTCTCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172027
ABTB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and BTB (POZ) domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-510s1c1
Sequence:CCGGCCAACATGCTGGACACCAAATCTCGAGATTTGGTGTCCAGCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172027.1-1568s1c1
Sequence:CCGGGACAAGCATGTGTATGCGTTTCTCGAGAAACGCATACACATGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-428s1c1
Sequence:CCGGCACAGTGACGTGGTCTTTGTACTCGAGTACAAAGACCACGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-632s1c1
Sequence:CCGGGTAGAGCATGTGAGTGACTGTCTCGAGACAGTCACTCACATGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-379s1c1
Sequence:CCGGGCGGGATTACTATGACGACTTCTCGAGAAGTCGTCATAGTAATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1075s1c1
Sequence:CCGGCTTCACTCACGTGCTCTACTACTCGAGTAGTAGAGCACGTGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-514s1c1
Sequence:CCGGCATGCTGGACACCAAATGGAACTCGAGTTCCATTTGGTGTCCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172027.1-1297s1c1
Sequence:CCGGCATGGCCAAGGTCATTGAGAACTCGAGTTCTCAATGACCTTGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172027.1-1303s1c1
Sequence:CCGGCAAGGTCATTGAGAAGCTGGTCTCGAGACCAGCTTCTCAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030251
VALIDATED
ABTB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and BTB (POZ) domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030251.1-1544s1c1
Sequence:CCGGCGCAGCAAGATGGCATTACAACTCGAGTTGTAATGCCATCTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-346s1c1
Sequence:CCGGGCGGGATTACTATGACGATTTCTCGAGAAATCGTCATAGTAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1408s1c1
Sequence:CCGGCCAGACATACAGTGCCATTGACTCGAGTCAATGGCACTGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-953s1c1
Sequence:CCGGCTTCTGGATGACCACTTTCAACTCGAGTTGAAAGTGGTCATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1409s1c1
Sequence:CCGGCAGACATACAGTGCCATTGAACTCGAGTTCAATGGCACTGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1106s21c1
Sequence:CCGGACGTGTTGTACTACGTATATACTCGAGTATATACGTAGTACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-403s21c1
Sequence:CCGGCGGGATTACTATGACGATTTCCTCGAGGAAATCGTCATAGTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-266s21c1
Sequence:CCGGTGCGCTACCTGTTGGCTAATGCTCGAGCATTAGCCAACAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1301s21c1
Sequence:CCGGAGGACCAGTGTACCGAGTATACTCGAGTATACTCGGTACACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030251
VALIDATED
ABTB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and BTB (POZ) domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030251.1-1544s1c1
Sequence:CCGGCGCAGCAAGATGGCATTACAACTCGAGTTGTAATGCCATCTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-346s1c1
Sequence:CCGGGCGGGATTACTATGACGATTTCTCGAGAAATCGTCATAGTAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1408s1c1
Sequence:CCGGCCAGACATACAGTGCCATTGACTCGAGTCAATGGCACTGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-953s1c1
Sequence:CCGGCTTCTGGATGACCACTTTCAACTCGAGTTGAAAGTGGTCATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1409s1c1
Sequence:CCGGCAGACATACAGTGCCATTGAACTCGAGTTCAATGGCACTGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1106s21c1
Sequence:CCGGACGTGTTGTACTACGTATATACTCGAGTATATACGTAGTACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-403s21c1
Sequence:CCGGCGGGATTACTATGACGATTTCCTCGAGGAAATCGTCATAGTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-266s21c1
Sequence:CCGGTGCGCTACCTGTTGGCTAATGCTCGAGCATTAGCCAACAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1301s21c1
Sequence:CCGGAGGACCAGTGTACCGAGTATACTCGAGTATACTCGGTACACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030251
VALIDATED
ABTB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and BTB (POZ) domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030251.1-1544s1c1
Sequence:CCGGCGCAGCAAGATGGCATTACAACTCGAGTTGTAATGCCATCTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-346s1c1
Sequence:CCGGGCGGGATTACTATGACGATTTCTCGAGAAATCGTCATAGTAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1408s1c1
Sequence:CCGGCCAGACATACAGTGCCATTGACTCGAGTCAATGGCACTGTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-953s1c1
Sequence:CCGGCTTCTGGATGACCACTTTCAACTCGAGTTGAAAGTGGTCATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030251.1-1409s1c1
Sequence:CCGGCAGACATACAGTGCCATTGAACTCGAGTTCAATGGCACTGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1106s21c1
Sequence:CCGGACGTGTTGTACTACGTATATACTCGAGTATATACGTAGTACAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-403s21c1
Sequence:CCGGCGGGATTACTATGACGATTTCCTCGAGGAAATCGTCATAGTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-266s21c1
Sequence:CCGGTGCGCTACCTGTTGGCTAATGCTCGAGCATTAGCCAACAGGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030251.3-1301s21c1
Sequence:CCGGAGGACCAGTGTACCGAGTATACTCGAGTATACTCGGTACACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks