EMAIL THIS PAGE TO A FRIEND

ACAA1

acetyl-CoA acyltransferase 1

30 Gene Product Result for
Synonyms: ACAA PTHIO THIO
UniProtKB ID: P09110, G5E935, Q96CA6
Gene ID:
Human(30) Summary: This gene encodes an enzyme operative in the beta-oxidation system of the peroxisomes. Deficiency of this enzyme leads to pseudo-Zellweger syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Zebrafish(431754) acetyl-Coenzyme A acyltransferase 1
chicken(770094) acetyl-CoA acyltransferase 1
cow(508324) acetyl-CoA acyltransferase 1
Horse(100050082) acetyl-CoA acyltransferase 1
domestic cat(101087343) acetyl-CoA acyltransferase 1
dog(477023) acetyl-CoA acyltransferase 1
sheep(101110625) acetyl-CoA acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405416 Anti-ACAA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA006764 Anti-ACAA1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100018 Anti-ACAA1 antibody produced in rabbit affinity isolated antibody rat, zebrafish, guinea pig, canine, bovine, rabbit, mouse, horse, human
western blot pricing
HPA007244 Anti-ACAA1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410610 Anti-ACAA1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402104 Monoclonal Anti-ACAA1 antibody produced in mouse clone 3F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB91020 Monoclonal Anti-ACAA1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2650, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91022 Monoclonal Anti-ACAA1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2662, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91023 Monoclonal Anti-ACAA1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2663, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91024 Monoclonal Anti-ACAA1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2660, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070991 MISSION® esiRNA esiRNA human ACAA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217153 predicted 1099
2 SASI_Hs01_00217154 predicted 1057
3 SASI_Hs01_00217155 predicted 1284
4 SASI_Hs01_00217156 predicted 424
5 SASI_Hs01_00217157 predicted 504
6 SASI_Hs01_00217158 predicted 1018
7 SASI_Hs02_00332159 predicted 426
8 SASI_Hs01_00217159 predicted 655
9 SASI_Hs01_00217160 predicted 668
10 SASI_Hs01_00217161 predicted 486
11 SASI_Hs01_00217162 predicted 1244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001607
VALIDATED
ACAA1 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acyltransferase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-439s1c1
Sequence:CCGGCCACTGTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-1340s1c1
Sequence:CCGGCGTCTTTGAATACCCTGGGAACTCGAGTTCCCAGGGTATTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-662s1c1
Sequence:CCGGGTTTGGCATTTCACGGGAGAACTCGAGTTCTCCCGTGAAATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-876s1c1
Sequence:CCGGGCCTTCAAGAAAGATGGTTCTCTCGAGAGAACCATCTTTCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001607
VALIDATED
ACAA1 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acyltransferase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-439s1c1
Sequence:CCGGCCACTGTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-1340s1c1
Sequence:CCGGCGTCTTTGAATACCCTGGGAACTCGAGTTCCCAGGGTATTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-662s1c1
Sequence:CCGGGTTTGGCATTTCACGGGAGAACTCGAGTTCTCCCGTGAAATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-876s1c1
Sequence:CCGGGCCTTCAAGAAAGATGGTTCTCTCGAGAGAACCATCTTTCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001607
VALIDATED
ACAA1 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acyltransferase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-439s1c1
Sequence:CCGGCCACTGTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001607.2-1340s1c1
Sequence:CCGGCGTCTTTGAATACCCTGGGAACTCGAGTTCCCAGGGTATTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-662s1c1
Sequence:CCGGGTTTGGCATTTCACGGGAGAACTCGAGTTCTCCCGTGAAATGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001607.2-876s1c1
Sequence:CCGGGCCTTCAAGAAAGATGGTTCTCTCGAGAGAACCATCTTTCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks