EMAIL THIS PAGE TO A FRIEND

ACAA2

acetyl-CoA acyltransferase 2

56 Gene Product Result for
Synonyms: DSAEC
UniProtKB ID: P42765, Q9BUT6
Gene ID:
Human(10449) Summary: The encoded protein catalyzes the last step of the mitochondrial fatty acid beta-oxidation spiral. Unlike most mitochondrial matrix proteins, it contains a non-cleavable amino-terminal targeting signal. [provided by RefSeq, Jul 2008]
Mouse(52538) acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)
Rat(170465) acetyl-CoA acyltransferase 2
naked mole-rat(101721744) acetyl-CoA acyltransferase 2
domestic guinea pig(100715434) acetyl-CoA acyltransferase 2
sheep(101111925) acetyl-CoA acyltransferase 2
Domestic Rabbit(100339733) acetyl-CoA acyltransferase 2
Zebrafish(406325) acetyl-CoA acyltransferase 2
cow(522006) acetyl-CoA acyltransferase 2
Horse(100069345) acetyl-CoA acyltransferase 2
domestic cat(101089302) acetyl-CoA acyltransferase 2
dog(490568) acetyl-CoA acyltransferase 2
chicken(426847) acetyl-CoA acyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006111 Rosetta Predictions human pricing
NM_130433 Rosetta Predictions rat pricing
NM_177470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340911 predicted 1224
2 SASI_Hs02_00340912 predicted 1391
3 SASI_Hs01_00159690 predicted 1131
4 SASI_Hs02_00340913 predicted 810
5 SASI_Hs02_00340914 predicted 1321
6 SASI_Hs02_00340915 predicted 1303
7 SASI_Hs02_00340916 predicted 796
8 SASI_Hs02_00340917 predicted 1168
9 SASI_Hs02_00340918 predicted 1335
10 SASI_Hs02_00340919 predicted 1210
11 SASI_Hs01_00159691 predicted 1347
12 SASI_Hs01_00159692 predicted 587
13 SASI_Hs01_00159693 predicted 720
14 SASI_Hs01_00159694 predicted 1241
15 SASI_Hs01_00159695 predicted 211
16 SASI_Hs01_00159696 predicted 183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267456 predicted 684
2 SASI_Rn01_00097471 predicted 598
3 SASI_Rn01_00097473 predicted 1089
4 SASI_Rn01_00097475 predicted 576
5 SASI_Rn01_00097476 predicted 1071
6 SASI_Rn01_00097477 predicted 331
7 SASI_Rn01_00097478 predicted 1101
8 SASI_Rn01_00097479 predicted 740
9 SASI_Rn01_00097480 predicted 317
10 SASI_Rn02_00267457 predicted 569
11 SASI_Rn01_00097472 predicted 663
12 SASI_Rn01_00097474 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139663 predicted 964
2 SASI_Mm01_00139664 predicted 651
3 SASI_Mm01_00139665 predicted 465
4 SASI_Mm01_00139666 predicted 926
5 SASI_Mm01_00139667 predicted 608
6 SASI_Mm01_00139668 predicted 894
7 SASI_Mm01_00139669 predicted 1006
8 SASI_Mm01_00139670 predicted 950
9 SASI_Mm01_00139671 predicted 527
10 SASI_Mm01_00139672 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006111
VALIDATED
ACAA2 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006111.2-1611s21c1
Sequence:CCGGGTGACCCATCCTTACTCTACTCTCGAGAGTAGAGTAAGGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-545s21c1
Sequence:CCGGACAGTTGACAGTGTGATTATGCTCGAGCATAATCACACTGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-479s21c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1172s21c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1485s21c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-823s1c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-130s1c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-877s1c1
Sequence:CCGGGCAAGAATTGTGGGCTACTTTCTCGAGAAAGTAGCCCACAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-1136s1c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-244s1c1
Sequence:CCGGGCTATATATTTGGCAAGGCATCTCGAGATGCCTTGCCAAATATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006111
VALIDATED
ACAA2 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006111.2-1611s21c1
Sequence:CCGGGTGACCCATCCTTACTCTACTCTCGAGAGTAGAGTAAGGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-545s21c1
Sequence:CCGGACAGTTGACAGTGTGATTATGCTCGAGCATAATCACACTGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-479s21c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1172s21c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1485s21c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-823s1c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-130s1c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-877s1c1
Sequence:CCGGGCAAGAATTGTGGGCTACTTTCTCGAGAAAGTAGCCCACAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-1136s1c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-244s1c1
Sequence:CCGGGCTATATATTTGGCAAGGCATCTCGAGATGCCTTGCCAAATATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006111
VALIDATED
ACAA2 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006111.2-1611s21c1
Sequence:CCGGGTGACCCATCCTTACTCTACTCTCGAGAGTAGAGTAAGGATGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-545s21c1
Sequence:CCGGACAGTTGACAGTGTGATTATGCTCGAGCATAATCACACTGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-479s21c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1172s21c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006111.2-1485s21c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-823s1c1
Sequence:CCGGGCTGTTATCATAGCTAGTGAACTCGAGTTCACTAGCTATGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-130s1c1
Sequence:CCGGACTGCTACTGACTTGTCTGAACTCGAGTTCAGACAAGTCAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-877s1c1
Sequence:CCGGGCAAGAATTGTGGGCTACTTTCTCGAGAAAGTAGCCCACAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-1136s1c1
Sequence:CCGGCACACCTGGTTCACGAATTAACTCGAGTTAATTCGTGAACCAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006111.1-244s1c1
Sequence:CCGGGCTATATATTTGGCAAGGCATCTCGAGATGCCTTGCCAAATATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177470
VALIDATED
ACAA2 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-1304s21c1
Sequence:CCGGTGCTGAGACAGTGATTGTATGCTCGAGCATACAATCACTGTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-900s1c1
Sequence:CCGGGATCCTACTATCATGGGTATTCTCGAGAATACCCATGATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-1126s1c1
Sequence:CCGGCACACCTGGTTCATGAGTTAACTCGAGTTAACTCATGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-891s21c1
Sequence:CCGGTCCGGATGCGATCCTACTATCCTCGAGGATAGTAGGATCGCATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-114s21c1
Sequence:CCGGGACTTCTCTGCCACCGATTTACTCGAGTAAATCGGTGGCAGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-922s21c1
Sequence:CCGGGTCCAGTCCCTGCTATCAATGCTCGAGCATTGATAGCAGGGACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-476s21c1
Sequence:CCGGTACTTTGTGGGCAGGATTAACCTCGAGGTTAATCCTGCCCACAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-488s1c1
Sequence:CCGGGCAGGATTAACGGATCAACATCTCGAGATGTTGATCCGTTAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-125s1c1
Sequence:CCGGGCCACCGATTTAACTGAATTTCTCGAGAAATTCAGTTAAATCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177470
VALIDATED
ACAA2 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-1304s21c1
Sequence:CCGGTGCTGAGACAGTGATTGTATGCTCGAGCATACAATCACTGTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-900s1c1
Sequence:CCGGGATCCTACTATCATGGGTATTCTCGAGAATACCCATGATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-1126s1c1
Sequence:CCGGCACACCTGGTTCATGAGTTAACTCGAGTTAACTCATGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-891s21c1
Sequence:CCGGTCCGGATGCGATCCTACTATCCTCGAGGATAGTAGGATCGCATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-114s21c1
Sequence:CCGGGACTTCTCTGCCACCGATTTACTCGAGTAAATCGGTGGCAGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-922s21c1
Sequence:CCGGGTCCAGTCCCTGCTATCAATGCTCGAGCATTGATAGCAGGGACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-476s21c1
Sequence:CCGGTACTTTGTGGGCAGGATTAACCTCGAGGTTAATCCTGCCCACAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-488s1c1
Sequence:CCGGGCAGGATTAACGGATCAACATCTCGAGATGTTGATCCGTTAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-125s1c1
Sequence:CCGGGCCACCGATTTAACTGAATTTCTCGAGAAATTCAGTTAAATCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177470
VALIDATED
ACAA2 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-1304s21c1
Sequence:CCGGTGCTGAGACAGTGATTGTATGCTCGAGCATACAATCACTGTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-900s1c1
Sequence:CCGGGATCCTACTATCATGGGTATTCTCGAGAATACCCATGATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.3-1126s1c1
Sequence:CCGGCACACCTGGTTCATGAGTTAACTCGAGTTAACTCATGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-891s21c1
Sequence:CCGGTCCGGATGCGATCCTACTATCCTCGAGGATAGTAGGATCGCATCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-114s21c1
Sequence:CCGGGACTTCTCTGCCACCGATTTACTCGAGTAAATCGGTGGCAGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-922s21c1
Sequence:CCGGGTCCAGTCCCTGCTATCAATGCTCGAGCATTGATAGCAGGGACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177470.3-476s21c1
Sequence:CCGGTACTTTGTGGGCAGGATTAACCTCGAGGTTAATCCTGCCCACAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-488s1c1
Sequence:CCGGGCAGGATTAACGGATCAACATCTCGAGATGTTGATCCGTTAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177470.2-125s1c1
Sequence:CCGGGCCACCGATTTAACTGAATTTCTCGAGAAATTCAGTTAAATCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks