EMAIL THIS PAGE TO A FRIEND

ACACA

acetyl-CoA carboxylase alpha

Synonyms: ACAC ACACAD ACC ACC1 ACCA
Gene ID:
Human(31) Summary: Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(107476) acetyl-Coenzyme A carboxylase alpha
Rat(60581) acetyl-CoA carboxylase alpha
Zebrafish(559403) acetyl-Coenzyme A carboxylase alpha
dog(491130) acetyl-CoA carboxylase alpha
cow(281590) acetyl-CoA carboxylase alpha
Horse(100071472) acetyl-CoA carboxylase alpha
domestic cat(101083046) acetyl-CoA carboxylase alpha
chicken(396504) acetyl-CoA carboxylase alpha
Goat(100861224) acetyl-CoA carboxylase alpha
Domestic Rabbit(100355970) acetyl-CoA carboxylase alpha
sheep(443186) acetyl-CoA carboxylase alpha
domestic guinea pig(100733410) acetyl-CoA carboxylase alpha
naked mole-rat(101706028) acetyl-CoA carboxylase alpha
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198834 Rosetta Predictions human pricing
NM_198836 Rosetta Predictions human pricing
NM_198837 Rosetta Predictions human pricing
NM_198838 Rosetta Predictions human pricing
NM_198839 Rosetta Predictions human pricing
NM_022193 Rosetta Predictions rat pricing
NM_133360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199146 predicted 4102
2 SASI_Hs01_00199147 predicted 4637
3 SASI_Hs02_00372334 predicted 2646
4 SASI_Hs01_00199148 predicted 7354
5 SASI_Hs01_00199149 predicted 5844
6 SASI_Hs01_00199150 predicted 2548
7 SASI_Hs01_00199152 predicted 2934
8 SASI_Hs02_00372335 predicted 6902
9 SASI_Hs02_00372336 predicted 3614
10 SASI_Hs01_00199154 predicted 2035
11 SASI_Hs01_00199151 predicted 1601
12 SASI_Hs01_00199153 predicted 6943
13 SASI_Hs01_00199155 predicted 5046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231111 predicted 3666
2 SASI_Hs01_00231112 predicted 4210
3 SASI_Hs02_00372337 predicted 2211
4 SASI_Hs01_00231113 predicted 6919
5 SASI_Hs01_00231114 predicted 5411
6 SASI_Hs01_00231115 predicted 2120
7 SASI_Hs01_00231117 predicted 2494
8 SASI_Hs02_00372338 predicted 6467
9 SASI_Hs02_00372339 predicted 3176
10 SASI_Hs01_00231119 predicted 1600
11 SASI_Hs01_00231116 predicted 1173
12 SASI_Hs01_00231118 predicted 6510
13 SASI_Hs01_00231120 predicted 4614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247151 predicted 3738
2 SASI_Hs01_00247152 predicted 4281
3 SASI_Hs02_00372340 predicted 2283
4 SASI_Hs01_00247153 predicted 6990
5 SASI_Hs01_00247154 predicted 5486
6 SASI_Hs01_00247155 predicted 2187
7 SASI_Hs01_00247157 predicted 2568
8 SASI_Hs02_00372341 predicted 6540
9 SASI_Hs02_00372342 predicted 3254
10 SASI_Hs01_00247159 predicted 1675
11 SASI_Hs01_00247156 predicted 1244
12 SASI_Hs01_00247158 predicted 6583
13 SASI_Hs01_00247160 predicted 4684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048680 predicted 3844
2 SASI_Hs01_00048681 predicted 4393
3 SASI_Hs02_00372343 predicted 2396
4 SASI_Hs01_00048682 predicted 7101
5 SASI_Hs01_00048683 predicted 5600
6 SASI_Hs01_00048684 predicted 2304
7 SASI_Hs01_00048686 predicted 2679
8 SASI_Hs02_00372344 predicted 6653
9 SASI_Hs02_00372345 predicted 3365
10 SASI_Hs01_00048688 predicted 1781
11 SASI_Hs01_00048685 predicted 1347
12 SASI_Hs01_00048687 predicted 6691
13 SASI_Hs01_00048689 predicted 4796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203584 predicted 4769
2 SASI_Hs01_00203585 predicted 5319
3 SASI_Hs02_00372346 predicted 3321
4 SASI_Hs01_00203586 predicted 8032
5 SASI_Hs01_00203587 predicted 6518
6 SASI_Hs01_00203588 predicted 3225
7 SASI_Hs01_00203590 predicted 3609
8 SASI_Hs02_00372347 predicted 7580
9 SASI_Hs02_00372348 predicted 4284
10 SASI_Hs01_00203592 predicted 2703
11 SASI_Hs01_00203589 predicted 2276
12 SASI_Hs01_00203591 predicted 7611
13 SASI_Hs01_00203593 predicted 5718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064612 predicted 6776
2 SASI_Rn01_00064613 predicted 4878
3 SASI_Rn01_00064614 predicted 4653
4 SASI_Rn01_00064615 predicted 1408
5 SASI_Rn01_00064616 predicted 416
6 SASI_Rn01_00064617 predicted 4728
7 SASI_Rn01_00064618 predicted 564
8 SASI_Rn01_00064619 predicted 397
9 SASI_Rn01_00064620 predicted 1799
10 SASI_Rn01_00064621 predicted 5784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115905 predicted 6797
2 SASI_Mm02_00338545 predicted 4103
3 SASI_Mm01_00115906 predicted 466
4 SASI_Mm01_00115907 predicted 1831
5 SASI_Mm01_00115908 predicted 438
6 SASI_Mm01_00115909 predicted 1435
7 SASI_Mm01_00115910 predicted 417
8 SASI_Mm01_00115911 predicted 6336
9 SASI_Mm01_00115912 predicted 3376
10 SASI_Mm01_00115914 predicted 3642
11 SASI_Mm01_00115913 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000664
VALIDATED
ACACA MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA carboxylase alpha
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000004766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-788s1c1
Sequence:CCGGGCTCAGATACACTCTCTGATTCTCGAGAATCAGAGAGTGTATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-666s1c1
Sequence:CCGGCCAGCACTCTCGATTCATAATCTCGAGATTATGAATCGAGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000664.3-572s1c1
Sequence:CCGGCTACTCAGACAGTAAGAATTACTCGAGTAATTCTTACTGTCTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-776s1c1
Sequence:CCGGCTGCTTCTGTTGGCTCAGATACTCGAGTATCTGAGCCAACAGAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000664
VALIDATED
ACACA MISSION shRNA shRNA Plasmid DNA
acetyl-CoA carboxylase alpha
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000004766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-788s1c1
Sequence:CCGGGCTCAGATACACTCTCTGATTCTCGAGAATCAGAGAGTGTATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-666s1c1
Sequence:CCGGCCAGCACTCTCGATTCATAATCTCGAGATTATGAATCGAGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000664.3-572s1c1
Sequence:CCGGCTACTCAGACAGTAAGAATTACTCGAGTAATTCTTACTGTCTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-776s1c1
Sequence:CCGGCTGCTTCTGTTGGCTCAGATACTCGAGTATCTGAGCCAACAGAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000664
VALIDATED
ACACA MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA carboxylase alpha
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000004766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-788s1c1
Sequence:CCGGGCTCAGATACACTCTCTGATTCTCGAGAATCAGAGAGTGTATCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-666s1c1
Sequence:CCGGCCAGCACTCTCGATTCATAATCTCGAGATTATGAATCGAGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000664.3-572s1c1
Sequence:CCGGCTACTCAGACAGTAAGAATTACTCGAGTAATTCTTACTGTCTGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000664.3-776s1c1
Sequence:CCGGCTGCTTCTGTTGGCTCAGATACTCGAGTATCTGAGCCAACAGAAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198834
VALIDATED
ACACA MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA carboxylase alpha
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4080s21c1
Sequence:CCGGGTATGTTCGAAGGGCTTATATCTCGAGATATAAGCCCTTCGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-9838s21c1
Sequence:CCGGTTGGACGGAGACCGCCATATTCTCGAGAATATGGCGGTCTCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4648s21c1
Sequence:CCGGTATGAGGTGGATCGGAGATTTCTCGAGAAATCTCCGATCCACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-5857s21c1
Sequence:CCGGTACAAGGGATACAGGTATTTACTCGAGTAAATACCTGTATCCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-6040s21c1
Sequence:CCGGGAATCCTCATTGGCCTATAATCTCGAGATTATAGGCCAATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198834
VALIDATED
ACACA MISSION shRNA shRNA Plasmid DNA
acetyl-CoA carboxylase alpha
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4080s21c1
Sequence:CCGGGTATGTTCGAAGGGCTTATATCTCGAGATATAAGCCCTTCGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-9838s21c1
Sequence:CCGGTTGGACGGAGACCGCCATATTCTCGAGAATATGGCGGTCTCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4648s21c1
Sequence:CCGGTATGAGGTGGATCGGAGATTTCTCGAGAAATCTCCGATCCACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-5857s21c1
Sequence:CCGGTACAAGGGATACAGGTATTTACTCGAGTAAATACCTGTATCCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-6040s21c1
Sequence:CCGGGAATCCTCATTGGCCTATAATCTCGAGATTATAGGCCAATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198834
VALIDATED
ACACA MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA carboxylase alpha
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4080s21c1
Sequence:CCGGGTATGTTCGAAGGGCTTATATCTCGAGATATAAGCCCTTCGAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-9838s21c1
Sequence:CCGGTTGGACGGAGACCGCCATATTCTCGAGAATATGGCGGTCTCCGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-4648s21c1
Sequence:CCGGTATGAGGTGGATCGGAGATTTCTCGAGAAATCTCCGATCCACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-5857s21c1
Sequence:CCGGTACAAGGGATACAGGTATTTACTCGAGTAAATACCTGTATCCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198834.1-6040s21c1
Sequence:CCGGGAATCCTCATTGGCCTATAATCTCGAGATTATAGGCCAATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks