EMAIL THIS PAGE TO A FRIEND

ACACB

acetyl-CoA carboxylase beta

82 Gene Product Result for
Synonyms: ACC2 ACCB HACC275
Gene ID:
Human(32) Summary: Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
Mouse(100705) acetyl-Coenzyme A carboxylase beta
Rat(116719) acetyl-CoA carboxylase beta
naked mole-rat(101717399) acetyl-CoA carboxylase beta
domestic guinea pig(100728089) acetyl-CoA carboxylase beta
sheep(101114816) acetyl-CoA carboxylase beta
Zebrafish(556236) acetyl-CoA carboxylase beta
domestic cat(101086680) acetyl-CoA carboxylase beta
Horse(100066740) acetyl-CoA carboxylase beta
cow(515338) acetyl-CoA carboxylase beta
dog(100685468) acetyl-CoA carboxylase beta
chicken(430557) acetyl-CoA carboxylase beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001093 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093 Rosetta Predictions human pricing
NM_053922 Rosetta Predictions rat pricing
NM_133904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052088 predicted 3907
2 SASI_Hs01_00052090 predicted 4507
3 SASI_Hs01_00052091 predicted 2582
4 SASI_Hs01_00052092 predicted 746
5 SASI_Hs02_00318090 predicted 5218
6 SASI_Hs01_00052093 predicted 5155
7 SASI_Hs01_00052094 predicted 4842
8 SASI_Hs01_00052095 predicted 6762
9 SASI_Hs02_00318091 predicted 4424
10 SASI_Hs02_00318092 predicted 6652
11 SASI_Hs01_00052089 predicted 999
12 SASI_Hs01_00052096 predicted 3785
13 SASI_Hs01_00052097 predicted 6625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266865 predicted 2564
2 SASI_Rn01_00099863 predicted 3774
3 SASI_Rn01_00099865 predicted 294
4 SASI_Rn02_00266866 predicted 5552
5 SASI_Rn01_00099866 predicted 2424
6 SASI_Rn01_00099867 predicted 974
7 SASI_Rn02_00266867 predicted 6009
8 SASI_Rn01_00099869 predicted 5344
9 SASI_Rn01_00099870 predicted 754
10 SASI_Rn01_00099871 predicted 4348
11 SASI_Rn01_00099864 predicted 3840
12 SASI_Rn01_00099868 predicted 3882
13 SASI_Rn01_00099872 predicted 2606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200600 predicted 2543
2 SASI_Mm01_00200601 predicted 958
3 SASI_Mm02_00338957 predicted 6710
4 SASI_Mm01_00200603 predicted 1626
5 SASI_Mm01_00200604 predicted 2434
6 SASI_Mm01_00200605 predicted 4330
7 SASI_Mm01_00200607 predicted 588
8 SASI_Mm01_00200608 predicted 2557
9 SASI_Mm01_00200609 predicted 5634
10 SASI_Mm02_00338958 predicted 4100
11 SASI_Mm01_00200602 predicted 2447
12 SASI_Mm01_00200606 predicted 5994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001093
VALIDATED
ACACB MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA carboxylase beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-1003s21c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093.3-7730s21c1
Sequence:CCGGTTGGATACCACATCGTGAAATCTCGAGATTTCACGATGTGGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-5069s21c1
Sequence:CCGGAGCACGGGATGCTGATCAATACTCGAGTATTGATCAGCATCCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2640s21c1
Sequence:CCGGCCGAATTACCATCGGCAATAACTCGAGTTATTGCCGATGGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2180s21c1
Sequence:CCGGTGTCCATCCGAGGCGACTTTACTCGAGTAAAGTCGCCTCGGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-991s1c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001093.x-6613s1c1
Sequence:CCGGGACGGCCTTAGACAATACAAACTCGAGTTTGTATTGTCTAAGGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-2429s1c1
Sequence:CCGGACCTCGTAGATGTGGAATTAACTCGAGTTAATTCCACATCTACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-5298s1c1
Sequence:CCGGCATCCTGACATACACTGAATTCTCGAGAATTCAGTGTATGTCAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-1937s1c1
Sequence:CCGGGCCACGTCATTGCCACCAGAACTCGAGTTCTGGTGGCAATGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001093
VALIDATED
ACACB MISSION shRNA shRNA Plasmid DNA
acetyl-CoA carboxylase beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-1003s21c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093.3-7730s21c1
Sequence:CCGGTTGGATACCACATCGTGAAATCTCGAGATTTCACGATGTGGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-5069s21c1
Sequence:CCGGAGCACGGGATGCTGATCAATACTCGAGTATTGATCAGCATCCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2640s21c1
Sequence:CCGGCCGAATTACCATCGGCAATAACTCGAGTTATTGCCGATGGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2180s21c1
Sequence:CCGGTGTCCATCCGAGGCGACTTTACTCGAGTAAAGTCGCCTCGGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-991s1c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001093.x-6613s1c1
Sequence:CCGGGACGGCCTTAGACAATACAAACTCGAGTTTGTATTGTCTAAGGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-2429s1c1
Sequence:CCGGACCTCGTAGATGTGGAATTAACTCGAGTTAATTCCACATCTACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-5298s1c1
Sequence:CCGGCATCCTGACATACACTGAATTCTCGAGAATTCAGTGTATGTCAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-1937s1c1
Sequence:CCGGGCCACGTCATTGCCACCAGAACTCGAGTTCTGGTGGCAATGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001093
VALIDATED
ACACB MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA carboxylase beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-1003s21c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001093.3-7730s21c1
Sequence:CCGGTTGGATACCACATCGTGAAATCTCGAGATTTCACGATGTGGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-5069s21c1
Sequence:CCGGAGCACGGGATGCTGATCAATACTCGAGTATTGATCAGCATCCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2640s21c1
Sequence:CCGGCCGAATTACCATCGGCAATAACTCGAGTTATTGCCGATGGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093.3-2180s21c1
Sequence:CCGGTGTCCATCCGAGGCGACTTTACTCGAGTAAAGTCGCCTCGGATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-991s1c1
Sequence:CCGGGTGGAGCTGATTGTGGACATTCTCGAGAATGTCCACAATCAGCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001093.x-6613s1c1
Sequence:CCGGGACGGCCTTAGACAATACAAACTCGAGTTTGTATTGTCTAAGGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-2429s1c1
Sequence:CCGGACCTCGTAGATGTGGAATTAACTCGAGTTAATTCCACATCTACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-5298s1c1
Sequence:CCGGCATCCTGACATACACTGAATTCTCGAGAATTCAGTGTATGTCAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001093.x-1937s1c1
Sequence:CCGGGCCACGTCATTGCCACCAGAACTCGAGTTCTGGTGGCAATGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks