EMAIL THIS PAGE TO A FRIEND

ACAD10

acyl-CoA dehydrogenase family, member 10

UniProtKB ID: Q6JQN1, G3XAJ0, Q8N828, Q8NAP2, Q96BX5
Gene ID:
Human(80724) Summary: This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Mouse(71985) acyl-Coenzyme A dehydrogenase family, member 10
Rat(304500) acyl-CoA dehydrogenase family, member 10
chicken(416879) acyl-Coenzyme A dehydrogenase family, member 10
cow(511425) acyl-CoA dehydrogenase family, member 10
Horse(100057702) acyl-CoA dehydrogenase family, member 10
domestic cat(101082952) acyl-CoA dehydrogenase family, member 10
dog(486272) acyl-CoA dehydrogenase family, member 10
Domestic Rabbit(100338272) acyl-CoA dehydrogenase family, member 10
domestic guinea pig(100729868) acyl-CoA dehydrogenase family, member 10
naked mole-rat(101707314) acyl-CoA dehydrogenase family, member 10
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025247 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025247 Rosetta Predictions human pricing
NM_001134537 Rosetta Predictions rat pricing
XR_009308 Rosetta Predictions rat pricing
NM_028037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138484 predicted 1847
2 SASI_Hs01_00138485 predicted 1006
3 SASI_Hs02_00358079 predicted 2351
4 SASI_Hs01_00138487 predicted 368
5 SASI_Hs01_00138488 predicted 1659
6 SASI_Hs02_00358080 predicted 549
7 SASI_Hs01_00138489 predicted 429
8 SASI_Hs01_00138490 predicted 2054
9 SASI_Hs01_00138491 predicted 1908
10 SASI_Hs01_00138492 predicted 3120
11 SASI_Hs01_00138486 predicted 342
12 SASI_Hs01_00138493 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256859 predicted 1667
2 SASI_Rn02_00256860 predicted 311
3 SASI_Rn02_00256861 predicted 697
4 SASI_Rn02_00256862 predicted 2059
5 SASI_Rn02_00256863 predicted 902
6 SASI_Rn02_00256864 predicted 892
7 SASI_Rn02_00256865 predicted 416
8 SASI_Rn02_00256866 predicted 405
9 SASI_Rn02_00256867 predicted 1702
10 SASI_Rn02_00256868 predicted 2291
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128187 predicted 510
2 SASI_Rn01_00128188 predicted 1385
3 SASI_Rn01_00128189 predicted 895
4 SASI_Rn01_00128190 predicted 3178
5 SASI_Rn01_00128191 predicted 1094
6 SASI_Rn01_00128192 predicted 3215
7 SASI_Rn01_00128193 predicted 1085
8 SASI_Rn01_00128194 predicted 606
9 SASI_Rn01_00128195 predicted 593
10 SASI_Rn01_00128196 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333194 predicted 1634
2 SASI_Mm01_00044716 predicted 3195
3 SASI_Mm02_00333195 predicted 553
4 SASI_Mm01_00044718 predicted 1923
5 SASI_Mm02_00333196 predicted 1027
6 SASI_Mm01_00044721 predicted 2663
7 SASI_Mm02_00333197 predicted 441
8 SASI_Mm01_00044722 predicted 1385
9 SASI_Mm01_00044723 predicted 903
10 SASI_Mm02_00333198 predicted 1828
11 SASI_Mm01_00044714 predicted 2643
12 SASI_Mm01_00044715 predicted 2678
13 SASI_Mm01_00044717 predicted 2675
14 SASI_Mm01_00044719 predicted 1419
15 SASI_Mm01_00044720 predicted 2889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028037
VALIDATED
ACAD10 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3651s1c1
Sequence:CCGGGAGTTTGGCATGGTCTGCTATCTCGAGATAGCAGACCATGCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-1404s1c1
Sequence:CCGGCCATGCCATAGAAAGGGAATTCTCGAGAATTCCCTTTCTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3403s1c1
Sequence:CCGGGCTTTAGACATTGCAATGATTCTCGAGAATCATTGCAATGTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028037.1-892s1c1
Sequence:CCGGGCAGTCCTCACCAACAACTTTCTCGAGAAAGTTGTTGGTGAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-2067s1c1
Sequence:CCGGCGACAACTGGAACTTCTACATCTCGAGATGTAGAAGTTCCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028037
VALIDATED
ACAD10 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3651s1c1
Sequence:CCGGGAGTTTGGCATGGTCTGCTATCTCGAGATAGCAGACCATGCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-1404s1c1
Sequence:CCGGCCATGCCATAGAAAGGGAATTCTCGAGAATTCCCTTTCTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3403s1c1
Sequence:CCGGGCTTTAGACATTGCAATGATTCTCGAGAATCATTGCAATGTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028037.1-892s1c1
Sequence:CCGGGCAGTCCTCACCAACAACTTTCTCGAGAAAGTTGTTGGTGAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-2067s1c1
Sequence:CCGGCGACAACTGGAACTTCTACATCTCGAGATGTAGAAGTTCCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028037
VALIDATED
ACAD10 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3651s1c1
Sequence:CCGGGAGTTTGGCATGGTCTGCTATCTCGAGATAGCAGACCATGCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-1404s1c1
Sequence:CCGGCCATGCCATAGAAAGGGAATTCTCGAGAATTCCCTTTCTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-3403s1c1
Sequence:CCGGGCTTTAGACATTGCAATGATTCTCGAGAATCATTGCAATGTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028037.1-892s1c1
Sequence:CCGGGCAGTCCTCACCAACAACTTTCTCGAGAAAGTTGTTGGTGAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028037.1-2067s1c1
Sequence:CCGGCGACAACTGGAACTTCTACATCTCGAGATGTAGAAGTTCCAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025247
ACAD10 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1937s1c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-607s1c1
Sequence:CCGGCCATAACTCAAATTCGGGCAACTCGAGTTGCCCGAATTTGAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1038s1c1
Sequence:CCGGCCATTGGAACTACTTCAGTTTCTCGAGAAACTGAAGTAGTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-319s21c1
Sequence:CCGGGCACCTACAGAGCGGTGATTTCTCGAGAAATCACCGCTCTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-3359s21c1
Sequence:CCGGAGAGCTGAAGCACCGCATTTACTCGAGTAAATGCGGTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-1952s21c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-870s21c1
Sequence:CCGGCTTGGTATTCACACCATTAAGCTCGAGCTTAATGGTGTGAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025247.5-3448s21c1
Sequence:CCGGCCTCGAAAGATCCGGTGTTTGCTCGAGCAAACACCGGATCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025247
ACAD10 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1937s1c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-607s1c1
Sequence:CCGGCCATAACTCAAATTCGGGCAACTCGAGTTGCCCGAATTTGAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1038s1c1
Sequence:CCGGCCATTGGAACTACTTCAGTTTCTCGAGAAACTGAAGTAGTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-319s21c1
Sequence:CCGGGCACCTACAGAGCGGTGATTTCTCGAGAAATCACCGCTCTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-3359s21c1
Sequence:CCGGAGAGCTGAAGCACCGCATTTACTCGAGTAAATGCGGTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-1952s21c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-870s21c1
Sequence:CCGGCTTGGTATTCACACCATTAAGCTCGAGCTTAATGGTGTGAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025247.5-3448s21c1
Sequence:CCGGCCTCGAAAGATCCGGTGTTTGCTCGAGCAAACACCGGATCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025247
ACAD10 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1937s1c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-607s1c1
Sequence:CCGGCCATAACTCAAATTCGGGCAACTCGAGTTGCCCGAATTTGAGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025247.2-1038s1c1
Sequence:CCGGCCATTGGAACTACTTCAGTTTCTCGAGAAACTGAAGTAGTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-319s21c1
Sequence:CCGGGCACCTACAGAGCGGTGATTTCTCGAGAAATCACCGCTCTGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-3359s21c1
Sequence:CCGGAGAGCTGAAGCACCGCATTTACTCGAGTAAATGCGGTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-1952s21c1
Sequence:CCGGGCTGACCGAATTTGTGTCTAACTCGAGTTAGACACAAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025247.5-870s21c1
Sequence:CCGGCTTGGTATTCACACCATTAAGCTCGAGCTTAATGGTGTGAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025247.5-3448s21c1
Sequence:CCGGCCTCGAAAGATCCGGTGTTTGCTCGAGCAAACACCGGATCTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks