EMAIL THIS PAGE TO A FRIEND

ACAD11

acyl-CoA dehydrogenase family, member 11

62 Gene Product Result for
Synonyms: ACAD-11
Gene ID:
Mouse(102632) acyl-Coenzyme A dehydrogenase family, member 11
Rat(315973) acyl-CoA dehydrogenase family, member 11
naked mole-rat(101712996) acyl-CoA dehydrogenase family, member 11
domestic guinea pig(100719812) acyl-CoA dehydrogenase family, member 11
sheep(101118915) acyl-CoA dehydrogenase family, member 11
Zebrafish(393147) acyl-Coenzyme A dehydrogenase family, member 11
cow(526956) acyl-CoA dehydrogenase family, member 11
domestic cat(101089137) acyl-CoA dehydrogenase family, member 11
dog(100686855) acyl-CoA dehydrogenase family, member 11
chicken(420689) acyl-CoA dehydrogenase family, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032169 Rosetta Predictions human pricing
NM_001108181 Rosetta Predictions rat pricing
NM_175324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041752 predicted 1063
2 SASI_Hs02_00359421 predicted 1234
3 SASI_Hs01_00041753 predicted 1961
4 SASI_Hs01_00041754 predicted 1518
5 SASI_Hs01_00041755 predicted 804
6 SASI_Hs01_00041756 predicted 1514
7 SASI_Hs01_00041757 predicted 2418
8 SASI_Hs02_00359422 predicted 1111
9 SASI_Hs02_00359423 predicted 1219
10 SASI_Hs01_00041761 predicted 2354
11 SASI_Hs01_00041758 predicted 990
12 SASI_Hs01_00041759 predicted 652
13 SASI_Hs01_00041760 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236134 predicted 2340
2 SASI_Rn02_00236135 predicted 1118
3 SASI_Rn02_00236136 predicted 658
4 SASI_Rn02_00236137 predicted 1480
5 SASI_Rn02_00236138 predicted 1126
6 SASI_Rn02_00236139 predicted 753
7 SASI_Rn02_00236140 predicted 1063
8 SASI_Rn02_00236141 predicted 957
9 SASI_Rn02_00236142 predicted 2004
10 SASI_Rn02_00236143 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023659 predicted 717
2 SASI_Mm01_00023660 predicted 741
3 SASI_Mm01_00023661 predicted 1099
4 SASI_Mm01_00023662 predicted 952
5 SASI_Mm01_00023663 predicted 1075
6 SASI_Mm01_00023664 predicted 381
7 SASI_Mm02_00346102 predicted 2256
8 SASI_Mm01_00023667 predicted 1541
9 SASI_Mm02_00346103 predicted 1474
10 SASI_Mm01_00023668 predicted 1025
11 SASI_Mm01_00023665 predicted 2274
12 SASI_Mm01_00023666 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032169
ACAD11 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032169.4-2815s21c1
Sequence:CCGGGTTTGAGCACAGGGTTAATTACTCGAGTAATTAACCCTGTGCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032169.4-756s21c1
Sequence:CCGGGGTCGAATCTTCCGTGATTTACTCGAGTAAATCACGGAAGATTCGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-2432s1c1
Sequence:CCGGGCTGGCGCTAAGAAAGAGATTCTCGAGAATCTCTTTCTTAGCGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-791s1c1
Sequence:CCGGGCTCAGTTACATTCCTTGAATCTCGAGATTCAAGGAATGTAACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1896s1c1
Sequence:CCGGGCATCCAACGAGATGAAGATACTCGAGTATCTTCATCTCGTTGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1305s1c1
Sequence:CCGGGCAGATATCTTCTGGGAAATACTCGAGTATTTCCCAGAAGATATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-572s1c1
Sequence:CCGGGCACATCAGATTGATAGAGAACTCGAGTTCTCTATCAATCTGATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032169
ACAD11 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032169.4-2815s21c1
Sequence:CCGGGTTTGAGCACAGGGTTAATTACTCGAGTAATTAACCCTGTGCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032169.4-756s21c1
Sequence:CCGGGGTCGAATCTTCCGTGATTTACTCGAGTAAATCACGGAAGATTCGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-2432s1c1
Sequence:CCGGGCTGGCGCTAAGAAAGAGATTCTCGAGAATCTCTTTCTTAGCGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-791s1c1
Sequence:CCGGGCTCAGTTACATTCCTTGAATCTCGAGATTCAAGGAATGTAACTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1896s1c1
Sequence:CCGGGCATCCAACGAGATGAAGATACTCGAGTATCTTCATCTCGTTGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1305s1c1
Sequence:CCGGGCAGATATCTTCTGGGAAATACTCGAGTATTTCCCAGAAGATATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-572s1c1
Sequence:CCGGGCACATCAGATTGATAGAGAACTCGAGTTCTCTATCAATCTGATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032169
ACAD11 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032169.4-2815s21c1
Sequence:CCGGGTTTGAGCACAGGGTTAATTACTCGAGTAATTAACCCTGTGCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032169.4-756s21c1
Sequence:CCGGGGTCGAATCTTCCGTGATTTACTCGAGTAAATCACGGAAGATTCGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-2432s1c1
Sequence:CCGGGCTGGCGCTAAGAAAGAGATTCTCGAGAATCTCTTTCTTAGCGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-791s1c1
Sequence:CCGGGCTCAGTTACATTCCTTGAATCTCGAGATTCAAGGAATGTAACTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1896s1c1
Sequence:CCGGGCATCCAACGAGATGAAGATACTCGAGTATCTTCATCTCGTTGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-1305s1c1
Sequence:CCGGGCAGATATCTTCTGGGAAATACTCGAGTATTTCCCAGAAGATATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032169.3-572s1c1
Sequence:CCGGGCACATCAGATTGATAGAGAACTCGAGTTCTCTATCAATCTGATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175324
VALIDATED
ACAD11 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1876s21c1
Sequence:CCGGCGTTCCTGCCAGCAACTTAATCTCGAGATTAAGTTGCTGGCAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-470s21c1
Sequence:CCGGGCAGAACGTGCTGCTATATATCTCGAGATATATAGCAGCACGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-2938s21c1
Sequence:CCGGCTGAGGAGATCCGTAACTAATCTCGAGATTAGTTACGGATCTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-427s21c1
Sequence:CCGGGGGTCGGATCTTTCGTGATTTCTCGAGAAATCACGAAAGATCCGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1816s21c1
Sequence:CCGGGTTCGGCTACATGGATAATATCTCGAGATATTATCCATGTAGCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175324.2-1409s1c1
Sequence:CCGGGATTGCTGAAGAGACAGGAAACTCGAGTTTCCTGTCTCTTCAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175324.2-3197s1c1
Sequence:CCGGGCATCCAAATAAACACAGTAACTCGAGTTACTGTGTTTATTTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175324
VALIDATED
ACAD11 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1876s21c1
Sequence:CCGGCGTTCCTGCCAGCAACTTAATCTCGAGATTAAGTTGCTGGCAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-470s21c1
Sequence:CCGGGCAGAACGTGCTGCTATATATCTCGAGATATATAGCAGCACGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-2938s21c1
Sequence:CCGGCTGAGGAGATCCGTAACTAATCTCGAGATTAGTTACGGATCTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-427s21c1
Sequence:CCGGGGGTCGGATCTTTCGTGATTTCTCGAGAAATCACGAAAGATCCGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1816s21c1
Sequence:CCGGGTTCGGCTACATGGATAATATCTCGAGATATTATCCATGTAGCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175324.2-1409s1c1
Sequence:CCGGGATTGCTGAAGAGACAGGAAACTCGAGTTTCCTGTCTCTTCAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175324.2-3197s1c1
Sequence:CCGGGCATCCAAATAAACACAGTAACTCGAGTTACTGTGTTTATTTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175324
VALIDATED
ACAD11 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1876s21c1
Sequence:CCGGCGTTCCTGCCAGCAACTTAATCTCGAGATTAAGTTGCTGGCAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-470s21c1
Sequence:CCGGGCAGAACGTGCTGCTATATATCTCGAGATATATAGCAGCACGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-2938s21c1
Sequence:CCGGCTGAGGAGATCCGTAACTAATCTCGAGATTAGTTACGGATCTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175324.3-427s21c1
Sequence:CCGGGGGTCGGATCTTTCGTGATTTCTCGAGAAATCACGAAAGATCCGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175324.3-1816s21c1
Sequence:CCGGGTTCGGCTACATGGATAATATCTCGAGATATTATCCATGTAGCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175324.2-1409s1c1
Sequence:CCGGGATTGCTGAAGAGACAGGAAACTCGAGTTTCCTGTCTCTTCAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175324.2-3197s1c1
Sequence:CCGGGCATCCAAATAAACACAGTAACTCGAGTTACTGTGTTTATTTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)