EMAIL THIS PAGE TO A FRIEND

ACAD8

acyl-CoA dehydrogenase family, member 8

57 Gene Product Result for
Synonyms: ACAD-8 ARC42
UniProtKB ID: Q9UKU7, Q9BUS8
Gene ID:
Human(27034) Summary: This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
Mouse(66948) acyl-Coenzyme A dehydrogenase family, member 8
Rat(367196) acyl-CoA dehydrogenase family, member 8
naked mole-rat(101709235) acyl-CoA dehydrogenase family, member 8
domestic guinea pig(100734642) acyl-CoA dehydrogenase family, member 8
sheep(101113789) acyl-CoA dehydrogenase family, member 8
Zebrafish(394130) acyl-Coenzyme A dehydrogenase family, member 8
cow(512070) acyl-CoA dehydrogenase family, member 8
Horse(100072888) acyl-CoA dehydrogenase family, member 8
chicken(419739) acyl-CoA dehydrogenase family, member 8
domestic cat(101097759) acyl-CoA dehydrogenase family, member 8
dog(479386) acyl-CoA dehydrogenase family, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014384 Rosetta Predictions human pricing
XM_346003 Rosetta Predictions rat pricing
NM_025862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184066 predicted 596
2 SASI_Hs01_00184067 predicted 556
3 SASI_Hs02_00345544 predicted 418
4 SASI_Hs01_00184071 predicted 518
5 SASI_Hs01_00184072 predicted 1236
6 SASI_Hs01_00184073 predicted 1309
7 SASI_Hs02_00345545 predicted 923
8 SASI_Hs01_00184074 predicted 990
9 SASI_Hs02_00345546 predicted 1345
10 SASI_Hs02_00345547 predicted 1280
11 SASI_Hs01_00184068 predicted 1294
12 SASI_Hs01_00184069 predicted 447
13 SASI_Hs01_00184070 predicted 611
14 SASI_Hs01_00184075 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398962 predicted 245
2 SASI_Rn01_00143542 predicted 280
3 SASI_Rn01_00143543 predicted 403
4 SASI_Rn01_00143544 predicted 358
5 SASI_Rn01_00143545 predicted 352
6 SASI_Rn01_00143546 predicted 231
7 SASI_Rn01_00143548 predicted 356
8 SASI_Rn01_00143549 predicted 367
9 SASI_Rn01_00143550 predicted 344
10 SASI_Rn02_00398963 predicted 373
11 SASI_Rn01_00143541 predicted 366
12 SASI_Rn01_00143547 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188209 predicted 402
2 SASI_Mm01_00188210 predicted 861
3 SASI_Mm01_00188211 predicted 632
4 SASI_Mm01_00188212 predicted 689
5 SASI_Mm01_00188215 predicted 1182
6 SASI_Mm01_00188216 predicted 403
7 SASI_Mm01_00188217 predicted 854
8 SASI_Mm02_00329172 predicted 1270
9 SASI_Mm01_00188218 predicted 1224
10 SASI_Mm02_00329173 predicted 683
11 SASI_Mm01_00188213 predicted 1237
12 SASI_Mm01_00188214 predicted 1461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014384
VALIDATED
ACAD8 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1270s1c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-671s1c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1016s1c1
Sequence:CCGGGCCAGTAACCAGTACTTGCAACTCGAGTTGCAAGTACTGGTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-257s1c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-481s1c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-644s21c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-454s21c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-230s21c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1573s21c1
Sequence:CCGGAGTGAAGATTCACCGTCAAACCTCGAGGTTTGACGGTGAATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1243s21c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014384
VALIDATED
ACAD8 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1270s1c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-671s1c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1016s1c1
Sequence:CCGGGCCAGTAACCAGTACTTGCAACTCGAGTTGCAAGTACTGGTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-257s1c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-481s1c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-644s21c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-454s21c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-230s21c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1573s21c1
Sequence:CCGGAGTGAAGATTCACCGTCAAACCTCGAGGTTTGACGGTGAATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1243s21c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014384
VALIDATED
ACAD8 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1270s1c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-671s1c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-1016s1c1
Sequence:CCGGGCCAGTAACCAGTACTTGCAACTCGAGTTGCAAGTACTGGTTACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-257s1c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014384.1-481s1c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-644s21c1
Sequence:CCGGGCTGGTGAGTCAGACATCTATCTCGAGATAGATGTCTGACTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-454s21c1
Sequence:CCGGGATGATTGATAGCTTCGGAAACTCGAGTTTCCGAAGCTATCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014384.2-230s21c1
Sequence:CCGGGCCCGAGAGATGGCTCCAAATCTCGAGATTTGGAGCCATCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1573s21c1
Sequence:CCGGAGTGAAGATTCACCGTCAAACCTCGAGGTTTGACGGTGAATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014384.2-1243s21c1
Sequence:CCGGCCAGATTCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025862
VALIDATED
ACAD8 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-432s1c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-694s1c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-1226s1c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025862.1-213s1c1
Sequence:CCGGGCTCGGGAAATGGCTCCCAATCTCGAGATTGGGAGCCATTTCCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-570s1c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-435s21c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-697s21c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-1229s21c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-573s21c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025862
VALIDATED
ACAD8 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-432s1c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-694s1c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-1226s1c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025862.1-213s1c1
Sequence:CCGGGCTCGGGAAATGGCTCCCAATCTCGAGATTGGGAGCCATTTCCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-570s1c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-435s21c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-697s21c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-1229s21c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-573s21c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025862
VALIDATED
ACAD8 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-432s1c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-694s1c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-1226s1c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025862.1-213s1c1
Sequence:CCGGGCTCGGGAAATGGCTCCCAATCTCGAGATTGGGAGCCATTTCCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025862.1-570s1c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-435s21c1
Sequence:CCGGGCCTGGATGATTGATAGCTTTCTCGAGAAAGCTATCAATCATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-697s21c1
Sequence:CCGGGCATAGTTGTTGAGAAAGGAACTCGAGTTCCTTTCTCAACAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-1229s21c1
Sequence:CCGGCCAGATCCTAGAAGGTAGCAACTCGAGTTGCTACCTTCTAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025862.2-573s21c1
Sequence:CCGGGCTAAACAACAAGGAGATCATCTCGAGATGATCTCCTTGTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks