EMAIL THIS PAGE TO A FRIEND

ACAD9

acyl-CoA dehydrogenase family, member 9

68 Gene Product Result for
Synonyms: NPD002
UniProtKB ID: Q9H845, D3DNB8, Q8WXX3
Gene ID:
Human(28976) Summary: This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Mouse(229211) acyl-Coenzyme A dehydrogenase family, member 9
Rat(294973) acyl-CoA dehydrogenase family, member 9
Zebrafish(724002) acyl-CoA dehydrogenase family, member 9
cow(617428) acyl-CoA dehydrogenase family, member 9
Horse(100054922) acyl-CoA dehydrogenase family, member 9
domestic cat(101086461) acyl-CoA dehydrogenase family, member 9
chicken(415974) acyl-CoA dehydrogenase family, member 9
dog(476519) acyl-CoA dehydrogenase family, member 9
Domestic Rabbit(100343898) acyl-CoA dehydrogenase family, member 9
domestic guinea pig(100713989) acyl-CoA dehydrogenase family, member 9
naked mole-rat(101698399) acyl-CoA dehydrogenase family, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014049 Rosetta Predictions human pricing
NM_181768 Rosetta Predictions rat pricing
NM_172678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174806 predicted 766
2 SASI_Hs01_00174809 predicted 355
3 SASI_Hs01_00174810 predicted 1364
4 SASI_Hs01_00174811 predicted 1339
5 SASI_Hs01_00174812 predicted 670
6 SASI_Hs01_00174814 predicted 284
7 SASI_Hs02_00345056 predicted 875
8 SASI_Hs02_00345057 predicted 1126
9 SASI_Hs02_00345058 predicted 239
10 SASI_Hs02_00345059 predicted 1136
11 SASI_Hs01_00174807 predicted 1031
12 SASI_Hs01_00174808 predicted 1685
13 SASI_Hs01_00174813 predicted 785
14 SASI_Hs01_00174815 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269791 predicted 222
2 SASI_Rn02_00269792 predicted 1559
3 SASI_Rn02_00269793 predicted 1272
4 SASI_Rn02_00269794 predicted 815
5 SASI_Rn02_00269795 predicted 837
6 SASI_Rn02_00269796 predicted 1656
7 SASI_Rn02_00269797 predicted 239
8 SASI_Rn02_00269798 predicted 1592
9 SASI_Rn02_00269799 predicted 1018
10 SASI_Rn02_00269800 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088627 predicted 1377
2 SASI_Mm01_00088628 predicted 759
3 SASI_Mm01_00088629 predicted 1626
4 SASI_Mm01_00088630 predicted 1104
5 SASI_Mm01_00088631 predicted 890
6 SASI_Mm01_00088632 predicted 1561
7 SASI_Mm01_00088633 predicted 912
8 SASI_Mm01_00088634 predicted 1791
9 SASI_Mm01_00088635 predicted 2066
10 SASI_Mm01_00088636 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014049
ACAD9 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-950s21c1
Sequence:CCGGGACTTTGGTGGAGTCACTAATCTCGAGATTAGTGACTCCACCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-1063s21c1
Sequence:CCGGAGAGGTCGGAGATGGGTTTAACTCGAGTTAAACCCATCTCCGACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-258s1c1
Sequence:CCGGGCCAAGATGAACTTAATGAAACTCGAGTTTCATTAAGTTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-854s1c1
Sequence:CCGGCCCGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1894s1c1
Sequence:CCGGCCTTGAGAAGCGAGCCTATATCTCGAGATATAGGCTCGCTTCTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1435s1c1
Sequence:CCGGCCATGAGCTTAAACAGGCCAACTCGAGTTGGCCTGTTTAAGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1084s1c1
Sequence:CCGGGCTCAGTGAATTTGGATTGATCTCGAGATCAATCCAAATTCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014049
ACAD9 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-950s21c1
Sequence:CCGGGACTTTGGTGGAGTCACTAATCTCGAGATTAGTGACTCCACCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-1063s21c1
Sequence:CCGGAGAGGTCGGAGATGGGTTTAACTCGAGTTAAACCCATCTCCGACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-258s1c1
Sequence:CCGGGCCAAGATGAACTTAATGAAACTCGAGTTTCATTAAGTTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-854s1c1
Sequence:CCGGCCCGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1894s1c1
Sequence:CCGGCCTTGAGAAGCGAGCCTATATCTCGAGATATAGGCTCGCTTCTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1435s1c1
Sequence:CCGGCCATGAGCTTAAACAGGCCAACTCGAGTTGGCCTGTTTAAGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1084s1c1
Sequence:CCGGGCTCAGTGAATTTGGATTGATCTCGAGATCAATCCAAATTCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014049
ACAD9 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-950s21c1
Sequence:CCGGGACTTTGGTGGAGTCACTAATCTCGAGATTAGTGACTCCACCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014049.4-1063s21c1
Sequence:CCGGAGAGGTCGGAGATGGGTTTAACTCGAGTTAAACCCATCTCCGACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-258s1c1
Sequence:CCGGGCCAAGATGAACTTAATGAAACTCGAGTTTCATTAAGTTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-854s1c1
Sequence:CCGGCCCGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1894s1c1
Sequence:CCGGCCTTGAGAAGCGAGCCTATATCTCGAGATATAGGCTCGCTTCTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1435s1c1
Sequence:CCGGCCATGAGCTTAAACAGGCCAACTCGAGTTGGCCTGTTTAAGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014049.3-1084s1c1
Sequence:CCGGGCTCAGTGAATTTGGATTGATCTCGAGATCAATCCAAATTCACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172678
VALIDATED
ACAD9 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase family, member 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-400s21c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-869s21c1
Sequence:CCGGGACTTCGGCGGAATCACTAATCTCGAGATTAGTGATTCCGCCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1729s21c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1376s21c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172678.3-2392s21c1
Sequence:CCGGTCTACGTACGGAATCATTTAACTCGAGTTAAATGATTCCGTACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172678.2-2114s1c1
Sequence:CCGGCCAGCCAAATTGTTGAAGAAACTCGAGTTTCTTCAACAATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1665s1c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1312s1c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-832s1c1
Sequence:CCGGCCGGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-336s1c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172678
VALIDATED
ACAD9 MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase family, member 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-400s21c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-869s21c1
Sequence:CCGGGACTTCGGCGGAATCACTAATCTCGAGATTAGTGATTCCGCCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1729s21c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1376s21c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172678.3-2392s21c1
Sequence:CCGGTCTACGTACGGAATCATTTAACTCGAGTTAAATGATTCCGTACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172678.2-2114s1c1
Sequence:CCGGCCAGCCAAATTGTTGAAGAAACTCGAGTTTCTTCAACAATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1665s1c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1312s1c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-832s1c1
Sequence:CCGGCCGGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-336s1c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172678
VALIDATED
ACAD9 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase family, member 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-400s21c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-869s21c1
Sequence:CCGGGACTTCGGCGGAATCACTAATCTCGAGATTAGTGATTCCGCCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1729s21c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172678.3-1376s21c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172678.3-2392s21c1
Sequence:CCGGTCTACGTACGGAATCATTTAACTCGAGTTAAATGATTCCGTACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172678.2-2114s1c1
Sequence:CCGGCCAGCCAAATTGTTGAAGAAACTCGAGTTTCTTCAACAATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1665s1c1
Sequence:CCGGCCTCATCAACTTGTATGGCATCTCGAGATGCCATACAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-1312s1c1
Sequence:CCGGGCCCGCATTCTCCTAATCTTTCTCGAGAAAGATTAGGAGAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-832s1c1
Sequence:CCGGCCGGAAGATAAATTAGGCATTCTCGAGAATGCCTAATTTATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172678.2-336s1c1
Sequence:CCGGCCCAGTTGACACCTTAGAGAACTCGAGTTCTCTAAGGTGTCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks