EMAIL THIS PAGE TO A FRIEND

ACADL

acyl-CoA dehydrogenase, long chain

64 Gene Product Result for
Synonyms: ACAD4 LCAD
UniProtKB ID: P28330, B2R8T3, Q8IUN8
Gene ID:
Human(33) Summary: The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family, which is a family of mitochondrial flavoenzymes involved in fatty acid and branched chain amino-acid metabolism. This protein is one of the four enzymes that catalyze the initial step of mitochondrial beta-oxidation of straight-chain fatty acid. Defects in this gene are the cause of long-chain acyl-CoA dehydrogenase (LCAD) deficiency, leading to nonketotic hypoglycemia. [provided by RefSeq, Jul 2008]
Mouse(11363) acyl-Coenzyme A dehydrogenase, long-chain
Rat(25287) acyl-CoA dehydrogenase, long chain
naked mole-rat(101698104) acyl-CoA dehydrogenase, long chain
domestic guinea pig(100723012) acyl-CoA dehydrogenase, long chain
sheep(101123271) acyl-CoA dehydrogenase, long chain
Zebrafish(394156) acyl-Coenzyme A dehydrogenase, long chain
chicken(424005) acyl-CoA dehydrogenase, long chain
dog(478895) acyl-CoA dehydrogenase, long chain
cow(614508) acyl-CoA dehydrogenase, long chain
domestic cat(101098884) acyl-CoA dehydrogenase, long chain
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001608 Rosetta Predictions human pricing
NM_012819 Rosetta Predictions rat pricing
NM_007381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144447 predicted 716
2 SASI_Hs01_00144449 predicted 1444
3 SASI_Hs02_00332160 predicted 860
4 SASI_Hs01_00144451 predicted 634
5 SASI_Hs01_00144452 predicted 1115
6 SASI_Hs01_00144453 predicted 475
7 SASI_Hs01_00144454 predicted 1326
8 SASI_Hs01_00144455 predicted 675
9 SASI_Hs01_00144456 predicted 1215
10 SASI_Hs02_00332161 predicted 1098
11 SASI_Hs01_00144448 predicted 637
12 SASI_Hs01_00144450 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113511 predicted 995
2 SASI_Rn01_00113512 predicted 1005
3 SASI_Rn01_00113513 predicted 742
4 SASI_Rn01_00113514 predicted 793
5 SASI_Rn01_00113515 predicted 301
6 SASI_Rn01_00113516 predicted 1102
7 SASI_Rn01_00113517 predicted 375
8 SASI_Rn01_00113518 predicted 1015
9 SASI_Rn01_00113519 predicted 625
10 SASI_Rn01_00113520 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174770 predicted 563
2 SASI_Mm01_00174771 predicted 556
3 SASI_Mm02_00311484 predicted 904
4 SASI_Mm01_00174772 predicted 1318
5 SASI_Mm01_00174773 predicted 503
6 SASI_Mm01_00174774 predicted 1236
7 SASI_Mm01_00174775 predicted 1393
8 SASI_Mm02_00311485 predicted 723
9 SASI_Mm01_00174777 predicted 495
10 SASI_Mm01_00174778 predicted 999
11 SASI_Mm01_00174769 predicted 1147
12 SASI_Mm01_00174776 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001608
VALIDATED
ACADL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, long chain
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1089s1c1
Sequence:CCGGCCAGGAACTATGTTAAACAAACTCGAGTTTGTTTAACATAGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1373s1c1
Sequence:CCGGGCCAGAGTTCAGCCAATCTATCTCGAGATAGATTGGCTGAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-693s1c1
Sequence:CCGGGAAGTGACTTACAGGGAATAACTCGAGTTATTCCCTGTAAGTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001608.2-1384s1c1
Sequence:CCGGGCCAATCTATGGTGGTACAAACTCGAGTTTGTACCACCATAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-880s1c1
Sequence:CCGGAGGATTTATCAAGGGACGAAACTCGAGTTTCGTCCCTTGATAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-1318s21c1
Sequence:CCGGACTGCTTGCATGGCGAAATATCTCGAGATATTTCGCCATGCAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-835s21c1
Sequence:CCGGTTCATCAGTAATGGGTCATTACTCGAGTAATGACCCATTACTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001608
VALIDATED
ACADL MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, long chain
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1089s1c1
Sequence:CCGGCCAGGAACTATGTTAAACAAACTCGAGTTTGTTTAACATAGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1373s1c1
Sequence:CCGGGCCAGAGTTCAGCCAATCTATCTCGAGATAGATTGGCTGAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-693s1c1
Sequence:CCGGGAAGTGACTTACAGGGAATAACTCGAGTTATTCCCTGTAAGTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001608.2-1384s1c1
Sequence:CCGGGCCAATCTATGGTGGTACAAACTCGAGTTTGTACCACCATAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-880s1c1
Sequence:CCGGAGGATTTATCAAGGGACGAAACTCGAGTTTCGTCCCTTGATAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-1318s21c1
Sequence:CCGGACTGCTTGCATGGCGAAATATCTCGAGATATTTCGCCATGCAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-835s21c1
Sequence:CCGGTTCATCAGTAATGGGTCATTACTCGAGTAATGACCCATTACTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001608
VALIDATED
ACADL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, long chain
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1089s1c1
Sequence:CCGGCCAGGAACTATGTTAAACAAACTCGAGTTTGTTTAACATAGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-1373s1c1
Sequence:CCGGGCCAGAGTTCAGCCAATCTATCTCGAGATAGATTGGCTGAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-693s1c1
Sequence:CCGGGAAGTGACTTACAGGGAATAACTCGAGTTATTCCCTGTAAGTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001608.2-1384s1c1
Sequence:CCGGGCCAATCTATGGTGGTACAAACTCGAGTTTGTACCACCATAGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001608.2-880s1c1
Sequence:CCGGAGGATTTATCAAGGGACGAAACTCGAGTTTCGTCCCTTGATAAATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-1318s21c1
Sequence:CCGGACTGCTTGCATGGCGAAATATCTCGAGATATTTCGCCATGCAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001608.3-835s21c1
Sequence:CCGGTTCATCAGTAATGGGTCATTACTCGAGTAATGACCCATTACTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007381
VALIDATED
ACADL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, long chain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1009s1c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-552s1c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007381.2-442s1c1
Sequence:CCGGCATGCCCTATATTGCGAATTACTCGAGTAATTCGCAATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1154s1c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1252s1c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-551s21c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1251s21c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1008s21c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1153s21c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007381
VALIDATED
ACADL MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, long chain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1009s1c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-552s1c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007381.2-442s1c1
Sequence:CCGGCATGCCCTATATTGCGAATTACTCGAGTAATTCGCAATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1154s1c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1252s1c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-551s21c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1251s21c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1008s21c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1153s21c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007381
VALIDATED
ACADL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, long chain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1009s1c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-552s1c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007381.2-442s1c1
Sequence:CCGGCATGCCCTATATTGCGAATTACTCGAGTAATTCGCAATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1154s1c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007381.2-1252s1c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-551s21c1
Sequence:CCGGGAAGTGACTTACAAGGAGTAACTCGAGTTACTCCTTGTAAGTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1251s21c1
Sequence:CCGGCGGTGGTACCAACGAAATAATCTCGAGATTATTTCGTTGGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1008s21c1
Sequence:CCGGGCAGCATAAACTAGCAGAATTCTCGAGAATTCTGCTAGTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007381.3-1153s21c1
Sequence:CCGGGTAGCTTATGAATGTGTGCAACTCGAGTTGCACACATTCATAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks