EMAIL THIS PAGE TO A FRIEND

ACADM

acyl-CoA dehydrogenase, C-4 to C-12 straight chain

62 Gene Product Result for
Synonyms: ACAD1 MCAD MCADH
UniProtKB ID: P11310, Q5T4U4, Q9NYF1
Gene ID:
Human(34) Summary: This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11364) acyl-Coenzyme A dehydrogenase, medium chain
Rat(24158) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Zebrafish(406283) acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
cow(505968) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Horse(100067343) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
domestic cat(101088421) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
dog(490207) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Domestic Rabbit(100347504) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
domestic guinea pig(100715842) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
naked mole-rat(101710282) acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000016 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030301 MISSION® esiRNA esiRNA human ACADM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000016 Rosetta Predictions human pricing
NM_001127328 Rosetta Predictions human pricing
NM_016986 Rosetta Predictions rat pricing
NM_007382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195583 predicted 1050
2 SASI_Hs01_00195584 predicted 823
3 SASI_Hs01_00195586 predicted 787
4 SASI_Hs01_00195587 predicted 1311
5 SASI_Hs02_00301667 predicted 937
6 SASI_Hs01_00195588 predicted 883
7 SASI_Hs01_00195589 predicted 1412
8 SASI_Hs01_00195590 predicted 1051
9 SASI_Hs01_00195591 predicted 1078
10 SASI_Hs01_00195592 predicted 1414
11 SASI_Hs01_00195585 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329147 predicted 1068
2 SASI_Hs02_00329148 predicted 835
3 SASI_Hs02_00329149 predicted 802
4 SASI_Hs02_00329150 predicted 1321
5 SASI_Hs02_00329151 predicted 951
6 SASI_Hs02_00329152 predicted 895
7 SASI_Hs02_00329153 predicted 1423
8 SASI_Hs02_00329154 predicted 1066
9 SASI_Hs02_00329155 predicted 1092
10 SASI_Hs02_00329156 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044358 predicted 1359
2 SASI_Rn01_00044359 predicted 417
3 SASI_Rn01_00044360 predicted 1201
4 SASI_Rn01_00044361 predicted 1010
5 SASI_Rn01_00044362 predicted 1250
6 SASI_Rn01_00044363 predicted 762
7 SASI_Rn01_00044364 predicted 267
8 SASI_Rn01_00044365 predicted 1371
9 SASI_Rn01_00044367 predicted 1229
10 SASI_Rn02_00261120 predicted 1218
11 SASI_Rn01_00044366 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112344 predicted 454
2 SASI_Mm01_00112345 predicted 1347
3 SASI_Mm01_00112346 predicted 1179
4 SASI_Mm01_00112347 predicted 497
5 SASI_Mm01_00112348 predicted 503
6 SASI_Mm01_00112349 predicted 362
7 SASI_Mm01_00112350 predicted 1230
8 SASI_Mm01_00112351 predicted 1266
9 SASI_Mm01_00112352 predicted 630
10 SASI_Mm01_00112353 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000016
ACADM MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-463s21c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1547s21c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1666s21c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1396s21c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-823s21c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-584s1c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1157s1c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1427s1c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1308s1c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-224s1c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000016
ACADM MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-463s21c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1547s21c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1666s21c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1396s21c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-823s21c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-584s1c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1157s1c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1427s1c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1308s1c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-224s1c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000016
ACADM MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-463s21c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1547s21c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1666s21c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-1396s21c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000016.4-823s21c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-584s1c1
Sequence:CCGGGCCTATTATTATTGCTGGAAACTCGAGTTTCCAGCAATAATAATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1157s1c1
Sequence:CCGGGCTGGCTGAAATGGCAATGAACTCGAGTTCATTGCCATTTCAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1427s1c1
Sequence:CCGGCCGTGAACACATTGACAAGTACTCGAGTACTTGTCAATGTGTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-1308s1c1
Sequence:CCGGGTGCAGATACTTGGAGGCAATCTCGAGATTGCCTCCAAGTATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000016.2-224s1c1
Sequence:CCGGCCTGAGAAGTATTTCTCGTTTCTCGAGAAACGAGAAATACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007382
VALIDATED
ACADM MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1187s21c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-553s21c1
Sequence:CCGGGTATGTTATCAACGGCCAGAACTCGAGTTCTGGCCGTTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-364s21c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1507s21c1
Sequence:CCGGGTTTGCTCTTTGATCACTTAACTCGAGTTAAGTGATCAAAGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-592s21c1
Sequence:CCGGGGGAAAGGCCAACTGGTATTTCTCGAGAAATACCAGTTGGCCTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-1187s1c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-103s1c1
Sequence:CCGGGCCCGGATTAGGGTTTAGTTTCTCGAGAAACTAAACCCTAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-364s1c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-987s1c1
Sequence:CCGGCGATGAAGGTTGAACTCGCTACTCGAGTAGCGAGTTCAACCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007382
VALIDATED
ACADM MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1187s21c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-553s21c1
Sequence:CCGGGTATGTTATCAACGGCCAGAACTCGAGTTCTGGCCGTTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-364s21c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1507s21c1
Sequence:CCGGGTTTGCTCTTTGATCACTTAACTCGAGTTAAGTGATCAAAGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-592s21c1
Sequence:CCGGGGGAAAGGCCAACTGGTATTTCTCGAGAAATACCAGTTGGCCTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-1187s1c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-103s1c1
Sequence:CCGGGCCCGGATTAGGGTTTAGTTTCTCGAGAAACTAAACCCTAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-364s1c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-987s1c1
Sequence:CCGGCGATGAAGGTTGAACTCGCTACTCGAGTAGCGAGTTCAACCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007382
VALIDATED
ACADM MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1187s21c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-553s21c1
Sequence:CCGGGTATGTTATCAACGGCCAGAACTCGAGTTCTGGCCGTTGATAACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-364s21c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-1507s21c1
Sequence:CCGGGTTTGCTCTTTGATCACTTAACTCGAGTTAAGTGATCAAAGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007382.4-592s21c1
Sequence:CCGGGGGAAAGGCCAACTGGTATTTCTCGAGAAATACCAGTTGGCCTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-1187s1c1
Sequence:CCGGGCCAAGATCTATCAGATTTATCTCGAGATAAATCTGATAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-103s1c1
Sequence:CCGGGCCCGGATTAGGGTTTAGTTTCTCGAGAAACTAAACCCTAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007382.1-364s1c1
Sequence:CCGGGCAAACTGCTATTGAAGCAAACTCGAGTTTGCTTCAATAGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007382.1-987s1c1
Sequence:CCGGCGATGAAGGTTGAACTCGCTACTCGAGTAGCGAGTTCAACCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks