EMAIL THIS PAGE TO A FRIEND

ACADS

acyl-CoA dehydrogenase, C-2 to C-3 short chain

62 Gene Product Result for
Synonyms: ACAD3 SCAD
UniProtKB ID: P16219, P78331
Gene ID:
Human(35) Summary: This gene encodes a a tetrameric mitochondrial flavoprotein, which is a member of the acyl-CoA dehydrogenase family. This enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Mutations in this gene have been associated with Short Chain Acyl-CoA Dehydrogenase Deficiency. [provided by RefSeq, Jul 2008]
Mouse(11409) acyl-Coenzyme A dehydrogenase, short chain
Rat(64304) acyl-CoA dehydrogenase, C-2 to C-3 short chain
naked mole-rat(101722158) acyl-CoA dehydrogenase, C-2 to C-3 short chain
domestic guinea pig(100733918) acyl-CoA dehydrogenase, C-2 to C-3 short chain
sheep(101119850) acyl-CoA dehydrogenase, C-2 to C-3 short chain
Domestic Rabbit(100352290) acyl-CoA dehydrogenase, C-2 to C-3 short chain
Zebrafish(445288) acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain
cow(511222) acyl-CoA dehydrogenase, C-2 to C-3 short chain
Horse(100147113) acyl-CoA dehydrogenase, C-2 to C-3 short chain
domestic cat(101082442) acyl-CoA dehydrogenase, C-2 to C-3 short chain
dog(477517) acyl-CoA dehydrogenase, C-2 to C-3 short chain
chicken(416969) acyl-CoA dehydrogenase, C-2 to C-3 short chain
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000017 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000017 Rosetta Predictions human pricing
NM_022512 Rosetta Predictions rat pricing
NM_007383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301668 predicted 453
2 SASI_Hs02_00301669 predicted 223
3 SASI_Hs01_00140237 predicted 637
4 SASI_Hs01_00140238 predicted 827
5 SASI_Hs01_00140239 predicted 1042
6 SASI_Hs02_00301670 predicted 257
7 SASI_Hs02_00301671 predicted 634
8 SASI_Hs02_00301672 predicted 646
9 SASI_Hs02_00301673 predicted 896
10 SASI_Hs02_00301674 predicted 1324
11 SASI_Hs01_00140240 predicted 480
12 SASI_Hs01_00140241 predicted 899
13 SASI_Hs01_00140242 predicted 1188
14 SASI_Hs01_00140243 predicted 952
15 SASI_Hs01_00140244 predicted 380
16 SASI_Hs01_00140245 predicted 1204
17 SASI_Hs01_00140246 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119276 predicted 365
2 SASI_Rn01_00119277 predicted 1199
3 SASI_Rn02_00263249 predicted 1180
4 SASI_Rn02_00263250 predicted 271
5 SASI_Rn02_00263251 predicted 1025
6 SASI_Rn01_00119279 predicted 1019
7 SASI_Rn01_00119280 predicted 743
8 SASI_Rn01_00119281 predicted 959
9 SASI_Rn01_00119282 predicted 1519
10 SASI_Rn01_00119284 predicted 364
11 SASI_Rn01_00119278 predicted 666
12 SASI_Rn01_00119283 predicted 299
13 SASI_Rn01_00119285 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146762 predicted 389
2 SASI_Mm01_00146764 predicted 587
3 SASI_Mm01_00146765 predicted 372
4 SASI_Mm01_00146766 predicted 902
5 SASI_Mm01_00146767 predicted 1316
6 SASI_Mm01_00146768 predicted 376
7 SASI_Mm01_00146769 predicted 966
8 SASI_Mm01_00146770 predicted 414
9 SASI_Mm01_00146771 predicted 1237
10 SASI_Mm02_00311486 predicted 1209
11 SASI_Mm01_00146763 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000017
VALIDATED
ACADS MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-179s1c1
Sequence:CCGGCGAGAAGGAGTTGTTTCCCATCTCGAGATGGGAAACAACTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000017.1-811s1c1
Sequence:CCGGGCTTCAAGATAGCCATGCAAACTCGAGTTTGCATGGCTATCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-368s1c1
Sequence:CCGGCGGAGTCATCATGAGTGTCAACTCGAGTTGACACTCATGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-561s1c1
Sequence:CCGGTGGGTTCTGAATGGAACCAAACTCGAGTTTGGTTCCATTCAGAACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-261s21c1
Sequence:CCGGTTGCCGAGAAGGAGTTGTTTCCTCGAGGAAACAACTCCTTCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000017.2-1484s21c1
Sequence:CCGGCCACCCAGATCAGATCACATGCTCGAGCATGTGATCTGATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-1123s21c1
Sequence:GTACCGGGGATAACAAGAAGCCTTTCATCTCGAGATGAAAGGCTTCTTGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-283s21c1
Sequence:CCGGCATTGCAGCCCAGGTGGATAACTCGAGTTATCCACCTGGGCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-888s21c1
Sequence:CCGGCAGGGATGGGCTTCAAGATAGCTCGAGCTATCTTGAAGCCCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000017
VALIDATED
ACADS MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-179s1c1
Sequence:CCGGCGAGAAGGAGTTGTTTCCCATCTCGAGATGGGAAACAACTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000017.1-811s1c1
Sequence:CCGGGCTTCAAGATAGCCATGCAAACTCGAGTTTGCATGGCTATCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-368s1c1
Sequence:CCGGCGGAGTCATCATGAGTGTCAACTCGAGTTGACACTCATGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-561s1c1
Sequence:CCGGTGGGTTCTGAATGGAACCAAACTCGAGTTTGGTTCCATTCAGAACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-261s21c1
Sequence:CCGGTTGCCGAGAAGGAGTTGTTTCCTCGAGGAAACAACTCCTTCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000017.2-1484s21c1
Sequence:CCGGCCACCCAGATCAGATCACATGCTCGAGCATGTGATCTGATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-1123s21c1
Sequence:GTACCGGGGATAACAAGAAGCCTTTCATCTCGAGATGAAAGGCTTCTTGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-283s21c1
Sequence:CCGGCATTGCAGCCCAGGTGGATAACTCGAGTTATCCACCTGGGCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-888s21c1
Sequence:CCGGCAGGGATGGGCTTCAAGATAGCTCGAGCTATCTTGAAGCCCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000017
VALIDATED
ACADS MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-179s1c1
Sequence:CCGGCGAGAAGGAGTTGTTTCCCATCTCGAGATGGGAAACAACTCCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000017.1-811s1c1
Sequence:CCGGGCTTCAAGATAGCCATGCAAACTCGAGTTTGCATGGCTATCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-368s1c1
Sequence:CCGGCGGAGTCATCATGAGTGTCAACTCGAGTTGACACTCATGATGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_000017.1-561s1c1
Sequence:CCGGTGGGTTCTGAATGGAACCAAACTCGAGTTTGGTTCCATTCAGAACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-261s21c1
Sequence:CCGGTTGCCGAGAAGGAGTTGTTTCCTCGAGGAAACAACTCCTTCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000017.2-1484s21c1
Sequence:CCGGCCACCCAGATCAGATCACATGCTCGAGCATGTGATCTGATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-1123s21c1
Sequence:GTACCGGGGATAACAAGAAGCCTTTCATCTCGAGATGAAAGGCTTCTTGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-283s21c1
Sequence:CCGGCATTGCAGCCCAGGTGGATAACTCGAGTTATCCACCTGGGCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000017.2-888s21c1
Sequence:CCGGCAGGGATGGGCTTCAAGATAGCTCGAGCTATCTTGAAGCCCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007383
VALIDATED
ACADS MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-394s1c1
Sequence:CCGGCGTCAACAATTCTCTCTACTTCTCGAGAAGTAGAGAGAATTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-467s1c1
Sequence:CCGGCCTTTCACCAATGGTGACAAACTCGAGTTTGTCACCATTGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-901s1c1
Sequence:CCGGCCTGGATTGTGCTGTGAAGTACTCGAGTACTTCACAGCACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-1199s1c1
Sequence:CCGGCGCATCACTGAGATCTACGAACTCGAGTTCGTAGATCTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-109s1c1
Sequence:CCGGGCGACGGTTACACACTGTTTACTCGAGTAAACAGTGTGTAACCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007383
VALIDATED
ACADS MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-394s1c1
Sequence:CCGGCGTCAACAATTCTCTCTACTTCTCGAGAAGTAGAGAGAATTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-467s1c1
Sequence:CCGGCCTTTCACCAATGGTGACAAACTCGAGTTTGTCACCATTGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-901s1c1
Sequence:CCGGCCTGGATTGTGCTGTGAAGTACTCGAGTACTTCACAGCACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-1199s1c1
Sequence:CCGGCGCATCACTGAGATCTACGAACTCGAGTTCGTAGATCTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-109s1c1
Sequence:CCGGGCGACGGTTACACACTGTTTACTCGAGTAAACAGTGTGTAACCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007383
VALIDATED
ACADS MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, C-2 to C-3 short chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-394s1c1
Sequence:CCGGCGTCAACAATTCTCTCTACTTCTCGAGAAGTAGAGAGAATTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-467s1c1
Sequence:CCGGCCTTTCACCAATGGTGACAAACTCGAGTTTGTCACCATTGGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-901s1c1
Sequence:CCGGCCTGGATTGTGCTGTGAAGTACTCGAGTACTTCACAGCACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-1199s1c1
Sequence:CCGGCGCATCACTGAGATCTACGAACTCGAGTTCGTAGATCTCAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007383.2-109s1c1
Sequence:CCGGGCGACGGTTACACACTGTTTACTCGAGTAAACAGTGTGTAACCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks