EMAIL THIS PAGE TO A FRIEND

ACADSB

acyl-CoA dehydrogenase, short/branched chain

63 Gene Product Result for
Synonyms: 2-MEBCAD ACAD7 SBCAD
UniProtKB ID: P45954, Q5SQN6, Q96CX7
Gene ID:
Human(36) Summary: Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Mouse(66885) acyl-Coenzyme A dehydrogenase, short/branched chain
Rat(25618) acyl-CoA dehydrogenase, short/branched chain
Zebrafish(100037342) acyl-CoA dehydrogenase, short/branched chain
dog(477856) acyl-CoA dehydrogenase, short/branched chain
cow(504301) acyl-CoA dehydrogenase, short/branched chain
domestic cat(101092794) acyl-CoA dehydrogenase, short/branched chain
chicken(423947) acyl-CoA dehydrogenase, short/branched chain
sheep(101102606) acyl-CoA dehydrogenase, short/branched chain
Domestic Rabbit(100351868) acyl-CoA dehydrogenase, short/branched chain
domestic guinea pig(100714817) acyl-CoA dehydrogenase, short/branched chain
naked mole-rat(101698912) acyl-CoA dehydrogenase, short/branched chain
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041251 MISSION® esiRNA esiRNA human ACADSB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001609 Rosetta Predictions human pricing
NM_013084 Rosetta Predictions rat pricing
NM_025826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198239 predicted 832
2 SASI_Hs01_00198240 predicted 342
3 SASI_Hs01_00198241 predicted 1157
4 SASI_Hs01_00198243 predicted 800
5 SASI_Hs02_00332162 predicted 1242
6 SASI_Hs01_00198244 predicted 1359
7 SASI_Hs01_00198245 predicted 945
8 SASI_Hs01_00198246 predicted 1037
9 SASI_Hs01_00198247 predicted 808
10 SASI_Hs01_00198248 predicted 977
11 SASI_Hs01_00198242 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098818 predicted 609
2 SASI_Rn01_00098819 predicted 1064
3 SASI_Rn01_00098820 predicted 946
4 SASI_Rn01_00098821 predicted 448
5 SASI_Rn01_00098822 predicted 966
6 SASI_Rn01_00098823 predicted 747
7 SASI_Rn01_00098824 predicted 279
8 SASI_Rn01_00098825 predicted 623
9 SASI_Rn01_00098826 predicted 295
10 SASI_Rn01_00098827 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029750 predicted 1112
2 SASI_Mm01_00029751 predicted 970
3 SASI_Mm01_00029752 predicted 286
4 SASI_Mm01_00029753 predicted 280
5 SASI_Mm01_00029754 predicted 842
6 SASI_Mm01_00029756 predicted 217
7 SASI_Mm01_00029757 predicted 971
8 SASI_Mm01_00029758 predicted 995
9 SASI_Mm01_00029759 predicted 744
10 SASI_Mm02_00329090 predicted 909
11 SASI_Mm01_00029755 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001609
VALIDATED
ACADSB MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, short/branched chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-786s21c1
Sequence:CCGGAGACCCTACCATTGGATATAACTCGAGTTATATCCAATGGTAGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001609.3-1600s21c1
Sequence:CCGGTAGGCACAGGAGATCCACTTTCTCGAGAAAGTGGATCTCCTGTGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-949s21c1
Sequence:CCGGCAAATTGGACATGGCTATAAGCTCGAGCTTATAGCCATGTCCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1144s1c1
Sequence:CCGGGCAGGACAAACAACGAGTAAACTCGAGTTTACTCGTTGTTTGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-120s1c1
Sequence:CCGGCCAGTCAGAAGCTCTACTCAACTCGAGTTGAGTAGAGCTTCTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001609.2-586s1c1
Sequence:CCGGGCTGATAAAGAGGGAGATTATCTCGAGATAATCTCCCTCTTTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1228s1c1
Sequence:CCGGGATGCAAAGATTGGTACGATACTCGAGTATCGTACCAATCTTTGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-713s1c1
Sequence:CCGGCCTTCTTAGTAGATCGTGATACTCGAGTATCACGATCTACTAAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001609
VALIDATED
ACADSB MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, short/branched chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-786s21c1
Sequence:CCGGAGACCCTACCATTGGATATAACTCGAGTTATATCCAATGGTAGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001609.3-1600s21c1
Sequence:CCGGTAGGCACAGGAGATCCACTTTCTCGAGAAAGTGGATCTCCTGTGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-949s21c1
Sequence:CCGGCAAATTGGACATGGCTATAAGCTCGAGCTTATAGCCATGTCCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1144s1c1
Sequence:CCGGGCAGGACAAACAACGAGTAAACTCGAGTTTACTCGTTGTTTGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-120s1c1
Sequence:CCGGCCAGTCAGAAGCTCTACTCAACTCGAGTTGAGTAGAGCTTCTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001609.2-586s1c1
Sequence:CCGGGCTGATAAAGAGGGAGATTATCTCGAGATAATCTCCCTCTTTATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1228s1c1
Sequence:CCGGGATGCAAAGATTGGTACGATACTCGAGTATCGTACCAATCTTTGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-713s1c1
Sequence:CCGGCCTTCTTAGTAGATCGTGATACTCGAGTATCACGATCTACTAAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001609
VALIDATED
ACADSB MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, short/branched chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-786s21c1
Sequence:CCGGAGACCCTACCATTGGATATAACTCGAGTTATATCCAATGGTAGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001609.3-1600s21c1
Sequence:CCGGTAGGCACAGGAGATCCACTTTCTCGAGAAAGTGGATCTCCTGTGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001609.3-949s21c1
Sequence:CCGGCAAATTGGACATGGCTATAAGCTCGAGCTTATAGCCATGTCCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1144s1c1
Sequence:CCGGGCAGGACAAACAACGAGTAAACTCGAGTTTACTCGTTGTTTGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-120s1c1
Sequence:CCGGCCAGTCAGAAGCTCTACTCAACTCGAGTTGAGTAGAGCTTCTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_001609.2-586s1c1
Sequence:CCGGGCTGATAAAGAGGGAGATTATCTCGAGATAATCTCCCTCTTTATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-1228s1c1
Sequence:CCGGGATGCAAAGATTGGTACGATACTCGAGTATCGTACCAATCTTTGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001609.2-713s1c1
Sequence:CCGGCCTTCTTAGTAGATCGTGATACTCGAGTATCACGATCTACTAAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025826
ACADSB MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, short/branched chain
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1361s21c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1008s21c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-846s21c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-387s21c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-236s21c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-137s1c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-747s1c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-1262s1c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-288s1c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-909s1c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025826
ACADSB MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, short/branched chain
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1361s21c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1008s21c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-846s21c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-387s21c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-236s21c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-137s1c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-747s1c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-1262s1c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-288s1c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-909s1c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025826
ACADSB MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, short/branched chain
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1361s21c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-1008s21c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-846s21c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-387s21c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025826.4-236s21c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-137s1c1
Sequence:CCGGCGTGTCCTCAAATCCTCACAACTCGAGTTGTGAGGATTTGAGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-747s1c1
Sequence:CCGGGCTTCTTAGTAGACCGAGATACTCGAGTATCTCGGTCTACTAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-1262s1c1
Sequence:CCGGGATGCCAAGATCGGTACAATACTCGAGTATTGTACCGATCTTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-288s1c1
Sequence:CCGGCCTCTATGGATGAGAACTCAACTCGAGTTGAGTTCTCATCCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025826.1-909s1c1
Sequence:CCGGGAAGTCTTAATGAAGGTAGAACTCGAGTTCTACCTTCATTAAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)