EMAIL THIS PAGE TO A FRIEND

ACADVL

acyl-CoA dehydrogenase, very long chain

84 Gene Product Result for
Synonyms: ACAD6 LCACD VLCAD
UniProtKB ID: P49748, B4DEB6, F5H2A9, O76056, Q8WUL0
Gene ID:
Human(37) Summary: The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11370) acyl-Coenzyme A dehydrogenase, very long chain
Rat(25363) acyl-CoA dehydrogenase, very long chain
naked mole-rat(101707761) acyl-CoA dehydrogenase, very long chain
domestic guinea pig(100713909) acyl-CoA dehydrogenase, very long chain
sheep(101117173) acyl-CoA dehydrogenase, very long chain
Zebrafish(573723) acyl-Coenzyme A dehydrogenase, very long chain
domestic cat(101094144) acyl-CoA dehydrogenase, very long chain
Horse(100061583) acyl-CoA dehydrogenase, very long chain
cow(282130) acyl-CoA dehydrogenase, very long chain
dog(489463) acyl-CoA dehydrogenase, very long chain
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000018 Rosetta Predictions human pricing
NM_001033859 Rosetta Predictions human pricing
NM_012891 Rosetta Predictions rat pricing
NM_017366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218349 predicted 1338
2 SASI_Hs02_00301675 predicted 1570
3 SASI_Hs01_00218351 predicted 1306
4 SASI_Hs01_00218352 predicted 1537
5 SASI_Hs01_00218353 predicted 1430
6 SASI_Hs01_00218355 predicted 1621
7 SASI_Hs01_00218356 predicted 1814
8 SASI_Hs02_00301676 predicted 921
9 SASI_Hs01_00218358 predicted 1207
10 SASI_Hs02_00301677 predicted 1229
11 SASI_Hs01_00218350 predicted 1225
12 SASI_Hs01_00218354 predicted 1323
13 SASI_Hs01_00218357 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054065 predicted 1265
2 SASI_Hs02_00308097 predicted 1502
3 SASI_Hs01_00054067 predicted 1242
4 SASI_Hs01_00054068 predicted 1471
5 SASI_Hs01_00054069 predicted 1371
6 SASI_Hs01_00054071 predicted 1550
7 SASI_Hs01_00054072 predicted 1748
8 SASI_Hs02_00308098 predicted 862
9 SASI_Hs01_00054074 predicted 1138
10 SASI_Hs02_00308099 predicted 1170
11 SASI_Hs01_00054066 predicted 1167
12 SASI_Hs01_00054070 predicted 1258
13 SASI_Hs01_00054073 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086022 predicted 507
2 SASI_Rn01_00086023 predicted 1466
3 SASI_Rn01_00086024 predicted 316
4 SASI_Rn01_00086025 predicted 1819
5 SASI_Rn01_00086026 predicted 517
6 SASI_Rn01_00086027 predicted 753
7 SASI_Rn01_00086028 predicted 1674
8 SASI_Rn01_00086029 predicted 1174
9 SASI_Rn01_00086031 predicted 923
10 SASI_Rn02_00260413 predicted 404
11 SASI_Rn01_00086030 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092086 predicted 569
2 SASI_Mm01_00092087 predicted 1509
3 SASI_Mm01_00092089 predicted 1652
4 SASI_Mm01_00092090 predicted 1791
5 SASI_Mm01_00092091 predicted 584
6 SASI_Mm02_00323844 predicted 1447
7 SASI_Mm01_00092088 predicted 1078
8 SASI_Mm01_00092092 predicted 820
9 SASI_Mm01_00092093 predicted 367
10 SASI_Mm01_00092094 predicted 1238
11 SASI_Mm01_00092095 predicted 1031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000018
VALIDATED
ACADVL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, very long chain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-851s1c1
Sequence:CCGGGCAGACATCTTCACGGTCTTTCTCGAGAAAGACCGTGAAGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1252s1c1
Sequence:CCGGGCAGTATGTAACTGAGTCCATCTCGAGATGGACTCAGTTACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-283s1c1
Sequence:CCGGCAAGGCGGAATCTAAGTCCTTCTCGAGAAGGACTTAGATTCCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-1010s1c1
Sequence:CCGGGAGGTGTTCTTTGATGGAGTACTCGAGTACTCCATCAAAGAACACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1172s1c1
Sequence:CCGGGCCACTAATCGTACCCAGTTTCTCGAGAAACTGGGTACGATTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1515s21c1
Sequence:CCGGTTCGCATCTTCCGGATCTTTGCTCGAGCAAAGATCCGGAAGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-918s21c1
Sequence:CCGGCAGACATCTTCACGGTCTTTGCTCGAGCAAAGACCGTGAAGATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1227s21c1
Sequence:CCGGCGGTAGATCATGCCACTAATCCTCGAGGATTAGTGGCATGATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1200s21c1
Sequence:CCGGGTACCATGAGAGGCATCATTGCTCGAGCAATGATGCCTCTCATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000018
VALIDATED
ACADVL MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, very long chain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-851s1c1
Sequence:CCGGGCAGACATCTTCACGGTCTTTCTCGAGAAAGACCGTGAAGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1252s1c1
Sequence:CCGGGCAGTATGTAACTGAGTCCATCTCGAGATGGACTCAGTTACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-283s1c1
Sequence:CCGGCAAGGCGGAATCTAAGTCCTTCTCGAGAAGGACTTAGATTCCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-1010s1c1
Sequence:CCGGGAGGTGTTCTTTGATGGAGTACTCGAGTACTCCATCAAAGAACACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1172s1c1
Sequence:CCGGGCCACTAATCGTACCCAGTTTCTCGAGAAACTGGGTACGATTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1515s21c1
Sequence:CCGGTTCGCATCTTCCGGATCTTTGCTCGAGCAAAGATCCGGAAGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-918s21c1
Sequence:CCGGCAGACATCTTCACGGTCTTTGCTCGAGCAAAGACCGTGAAGATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1227s21c1
Sequence:CCGGCGGTAGATCATGCCACTAATCCTCGAGGATTAGTGGCATGATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1200s21c1
Sequence:CCGGGTACCATGAGAGGCATCATTGCTCGAGCAATGATGCCTCTCATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000018
VALIDATED
ACADVL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, very long chain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-851s1c1
Sequence:CCGGGCAGACATCTTCACGGTCTTTCTCGAGAAAGACCGTGAAGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1252s1c1
Sequence:CCGGGCAGTATGTAACTGAGTCCATCTCGAGATGGACTCAGTTACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-283s1c1
Sequence:CCGGCAAGGCGGAATCTAAGTCCTTCTCGAGAAGGACTTAGATTCCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000018.1-1010s1c1
Sequence:CCGGGAGGTGTTCTTTGATGGAGTACTCGAGTACTCCATCAAAGAACACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000018.1-1172s1c1
Sequence:CCGGGCCACTAATCGTACCCAGTTTCTCGAGAAACTGGGTACGATTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1515s21c1
Sequence:CCGGTTCGCATCTTCCGGATCTTTGCTCGAGCAAAGATCCGGAAGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-918s21c1
Sequence:CCGGCAGACATCTTCACGGTCTTTGCTCGAGCAAAGACCGTGAAGATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1227s21c1
Sequence:CCGGCGGTAGATCATGCCACTAATCCTCGAGGATTAGTGGCATGATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000018.2-1200s21c1
Sequence:CCGGGTACCATGAGAGGCATCATTGCTCGAGCAATGATGCCTCTCATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017366
VALIDATED
ACADVL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA dehydrogenase, very long chain
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1161s1c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-869s1c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017366.1-417s1c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-149s1c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1239s1c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-869s21c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-149s21c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-417s21c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1161s21c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1239s21c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017366
VALIDATED
ACADVL MISSION shRNA shRNA Plasmid DNA
acyl-CoA dehydrogenase, very long chain
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1161s1c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-869s1c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017366.1-417s1c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-149s1c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1239s1c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-869s21c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-149s21c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-417s21c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1161s21c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1239s21c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017366
VALIDATED
ACADVL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA dehydrogenase, very long chain
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1161s1c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-869s1c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017366.1-417s1c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-149s1c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017366.1-1239s1c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-869s21c1
Sequence:CCGGCTTTGCCAAGACGCCAATTAACTCGAGTTAATTGGCGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-149s21c1
Sequence:CCGGGCGATCTACTACTGTGCTTCACTCGAGTGAAGCACAGTAGTAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-417s21c1
Sequence:CCGGCGGTTCTTTGAGGAAGTGAATCTCGAGATTCACTTCCTCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1161s21c1
Sequence:CCGGGCGGTTGATCATGCTACTAATCTCGAGATTAGTAGCATGATCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017366.2-1239s21c1
Sequence:CCGGCGGATGGCTATTCTGCAGTATCTCGAGATACTGCAGAATAGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks