EMAIL THIS PAGE TO A FRIEND

ACAP1

ArfGAP with coiled-coil, ankyrin repeat and PH domains 1

52 Gene Product Result for
Synonyms: CENTB1
UniProtKB ID: Q15027, Q53XN9
Gene ID:
Mouse(216859) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Rat(287443) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Zebrafish(561771) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
domestic cat(101096771) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
cow(508582) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Horse(100072970) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
dog(479481) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
sheep(101119319) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Domestic Rabbit(100359236) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
domestic guinea pig(100715500) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
naked mole-rat(101718492) ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014716 Rosetta Predictions human pricing
NM_001105796 Rosetta Predictions rat pricing
NM_153788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177947 predicted 715
2 SASI_Hs01_00177950 predicted 1573
3 SASI_Hs02_00346141 predicted 1006
4 SASI_Hs02_00346142 predicted 1715
5 SASI_Hs01_00177951 predicted 1610
6 SASI_Hs01_00177952 predicted 259
7 SASI_Hs01_00177953 predicted 354
8 SASI_Hs01_00177954 predicted 729
9 SASI_Hs01_00177955 predicted 394
10 SASI_Hs01_00177956 predicted 2230
11 SASI_Hs01_00177948 predicted 470
12 SASI_Hs01_00177949 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212616 predicted 552
2 SASI_Rn02_00212617 predicted 705
3 SASI_Rn02_00212618 predicted 531
4 SASI_Rn02_00212619 predicted 403
5 SASI_Rn02_00212620 predicted 410
6 SASI_Rn02_00212621 predicted 728
7 SASI_Rn02_00212622 predicted 723
8 SASI_Rn02_00212623 predicted 612
9 SASI_Rn02_00212624 predicted 709
10 SASI_Rn02_00212625 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181327 predicted 724
2 SASI_Mm01_00181328 predicted 2247
3 SASI_Mm01_00181329 predicted 1720
4 SASI_Mm01_00181330 predicted 2085
5 SASI_Mm02_00343512 predicted 1157
6 SASI_Mm02_00343513 predicted 988
7 SASI_Mm01_00181331 predicted 729
8 SASI_Mm01_00181332 predicted 1135
9 SASI_Mm01_00181333 predicted 1600
10 SASI_Mm01_00181336 predicted 348
11 SASI_Mm01_00181334 predicted 2250
12 SASI_Mm01_00181335 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014716
ACAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1967s1c1
Sequence:CCGGGCTGATGTCAACTGGGTCAATCTCGAGATTGACCCAGTTGACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1711s1c1
Sequence:CCGGTCACGCTAAATACGTGGAGAACTCGAGTTCTCCACGTATTTAGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1039s1c1
Sequence:CCGGCTGGTTCACCATTCAGAGCAACTCGAGTTGCTCTGAATGGTGAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-351s1c1
Sequence:CCGGGCGCCTTCGTTGTCGGCATTTCTCGAGAAATGCCGACAACGAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-2300s1c1
Sequence:CCGGGCAGGAGATGAGACGTATCTTCTCGAGAAGATACGTCTCATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014716
ACAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1967s1c1
Sequence:CCGGGCTGATGTCAACTGGGTCAATCTCGAGATTGACCCAGTTGACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1711s1c1
Sequence:CCGGTCACGCTAAATACGTGGAGAACTCGAGTTCTCCACGTATTTAGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1039s1c1
Sequence:CCGGCTGGTTCACCATTCAGAGCAACTCGAGTTGCTCTGAATGGTGAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-351s1c1
Sequence:CCGGGCGCCTTCGTTGTCGGCATTTCTCGAGAAATGCCGACAACGAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-2300s1c1
Sequence:CCGGGCAGGAGATGAGACGTATCTTCTCGAGAAGATACGTCTCATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014716
ACAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1967s1c1
Sequence:CCGGGCTGATGTCAACTGGGTCAATCTCGAGATTGACCCAGTTGACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1711s1c1
Sequence:CCGGTCACGCTAAATACGTGGAGAACTCGAGTTCTCCACGTATTTAGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-1039s1c1
Sequence:CCGGCTGGTTCACCATTCAGAGCAACTCGAGTTGCTCTGAATGGTGAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-351s1c1
Sequence:CCGGGCGCCTTCGTTGTCGGCATTTCTCGAGAAATGCCGACAACGAAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014716.2-2300s1c1
Sequence:CCGGGCAGGAGATGAGACGTATCTTCTCGAGAAGATACGTCTCATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153788
ACAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2228s1c1
Sequence:CCGGCTCTGACTATCGCAATGGAAACTCGAGTTTCCATTGCGATAGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2328s1c1
Sequence:CCGGCGAGACGTATCTCGACATATTCTCGAGAATATGTCGAGATACGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2227s1c1
Sequence:CCGGCCTCTGACTATCGCAATGGAACTCGAGTTCCATTGCGATAGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-257s1c1
Sequence:CCGGCCTCGATTGAACTGGTGGAAACTCGAGTTTCCACCAGTTCAATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-1723s1c1
Sequence:CCGGGCCTGGATTCATGCCAAGTATCTCGAGATACTTGGCATGAATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153788
ACAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2228s1c1
Sequence:CCGGCTCTGACTATCGCAATGGAAACTCGAGTTTCCATTGCGATAGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2328s1c1
Sequence:CCGGCGAGACGTATCTCGACATATTCTCGAGAATATGTCGAGATACGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2227s1c1
Sequence:CCGGCCTCTGACTATCGCAATGGAACTCGAGTTCCATTGCGATAGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-257s1c1
Sequence:CCGGCCTCGATTGAACTGGTGGAAACTCGAGTTTCCACCAGTTCAATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-1723s1c1
Sequence:CCGGGCCTGGATTCATGCCAAGTATCTCGAGATACTTGGCATGAATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153788
ACAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2228s1c1
Sequence:CCGGCTCTGACTATCGCAATGGAAACTCGAGTTTCCATTGCGATAGTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2328s1c1
Sequence:CCGGCGAGACGTATCTCGACATATTCTCGAGAATATGTCGAGATACGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-2227s1c1
Sequence:CCGGCCTCTGACTATCGCAATGGAACTCGAGTTCCATTGCGATAGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-257s1c1
Sequence:CCGGCCTCGATTGAACTGGTGGAAACTCGAGTTTCCACCAGTTCAATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153788.2-1723s1c1
Sequence:CCGGGCCTGGATTCATGCCAAGTATCTCGAGATACTTGGCATGAATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)