EMAIL THIS PAGE TO A FRIEND

ACAP3

ArfGAP with coiled-coil, ankyrin repeat and PH domains 3

51 Gene Product Result for
Synonyms: CENTB5
Gene ID:
Mouse(140500) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Rat(313772) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
chicken(419420) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
cow(515444) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
domestic cat(101084014) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
dog(489597) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
sheep(101107717) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
domestic guinea pig(100729765) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
naked mole-rat(101718770) ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030649 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030649 Rosetta Predictions human pricing
NM_001107999 Rosetta Predictions rat pricing
NM_207223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010001 predicted 382
2 SASI_Hs01_00010004 predicted 709
3 SASI_Hs01_00010005 predicted 545
4 SASI_Hs01_00010006 predicted 2016
5 SASI_Hs02_00358226 predicted 1390
6 SASI_Hs01_00010008 predicted 229
7 SASI_Hs01_00010009 predicted 1275
8 SASI_Hs01_00010010 predicted 823
9 SASI_Hs02_00358227 predicted 622
10 SASI_Hs02_00358228 predicted 1065
11 SASI_Hs01_00010002 predicted 486
12 SASI_Hs01_00010003 predicted 427
13 SASI_Hs01_00010007 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234365 predicted 2446
2 SASI_Rn02_00234366 predicted 1767
3 SASI_Rn02_00234367 predicted 1747
4 SASI_Rn02_00234368 predicted 2462
5 SASI_Rn02_00234369 predicted 1622
6 SASI_Rn02_00234370 predicted 1464
7 SASI_Rn02_00234371 predicted 2025
8 SASI_Rn02_00234372 predicted 2155
9 SASI_Rn02_00234373 predicted 2012
10 SASI_Rn02_00234374 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092526 predicted 2363
2 SASI_Mm01_00092527 predicted 2853
3 SASI_Mm01_00092529 predicted 1536
4 SASI_Mm01_00092530 predicted 1464
5 SASI_Mm01_00092531 predicted 1484
6 SASI_Mm02_00351943 predicted 2269
7 SASI_Mm02_00351944 predicted 2027
8 SASI_Mm01_00092532 predicted 686
9 SASI_Mm01_00092533 predicted 1682
10 SASI_Mm01_00092534 predicted 1627
11 SASI_Mm01_00092528 predicted 761
12 SASI_Mm01_00092535 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207223
ACAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207223.1-3984s1c1
Sequence:CCGGGCCCACCAATGCCTTCAATTTCTCGAGAAATTGAAGGCATTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-773s1c1
Sequence:CCGGCTACAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-772s1c1
Sequence:CCGGCCTACAGGAGATGGTCAACTACTCGAGTAGTTGACCATCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207223
ACAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207223.1-3984s1c1
Sequence:CCGGGCCCACCAATGCCTTCAATTTCTCGAGAAATTGAAGGCATTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-773s1c1
Sequence:CCGGCTACAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-772s1c1
Sequence:CCGGCCTACAGGAGATGGTCAACTACTCGAGTAGTTGACCATCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207223
ACAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207223.1-3984s1c1
Sequence:CCGGGCCCACCAATGCCTTCAATTTCTCGAGAAATTGAAGGCATTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-773s1c1
Sequence:CCGGCTACAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207223.1-772s1c1
Sequence:CCGGCCTACAGGAGATGGTCAACTACTCGAGTAGTTGACCATCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030649
VALIDATED
ACAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-207s1c1
Sequence:CCGGCAAAGAGGATGTGCGGAAGTTCTCGAGAACTTCCGCACATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-710s1c1
Sequence:CCGGCCAGCAACGCTTTCAAGACATCTCGAGATGTCTTGAAAGCGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-713s1c1
Sequence:CCGGGCAACGCTTTCAAGACATGGACTCGAGTCCATGTCTTGAAAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030649.1-408s1c1
Sequence:CCGGGCAGGCCAAGAAGAAGTTTGACTCGAGTCAAACTTCTTCTTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-636s1c1
Sequence:CCGGCGATGAGTCCAAAGTGGAGTTCTCGAGAACTCCACTTTGGACTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-196s1c1
Sequence:CCGGCAGAGCTTTGTCAAAGAGGATCTCGAGATCCTCTTTGACAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-2414s21c1
Sequence:CCGGCAACGCTGACATCGTGACACTCTCGAGAGTGTCACGATGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-751s21c1
Sequence:CCGGTGATCGACTCTGCGGTGGAAACTCGAGTTTCCACCGCAGAGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-1031s21c1
Sequence:CCGGTGTGAAGCCGTGTGAGGACATCTCGAGATGTCCTCACACGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030649.2-2867s21c1
Sequence:CCGGGCTCATGTCACAAGCCACTTTCTCGAGAAAGTGGCTTGTGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-583s21c1
Sequence:CCGGACTATGTGCTCCAGATCAATGCTCGAGCATTGATCTGGAGCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-286s21c1
Sequence:CCGGACACCGTCATCTCGGAATGTCCTCGAGGACATTCCGAGATGACGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030649
VALIDATED
ACAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-207s1c1
Sequence:CCGGCAAAGAGGATGTGCGGAAGTTCTCGAGAACTTCCGCACATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-710s1c1
Sequence:CCGGCCAGCAACGCTTTCAAGACATCTCGAGATGTCTTGAAAGCGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-713s1c1
Sequence:CCGGGCAACGCTTTCAAGACATGGACTCGAGTCCATGTCTTGAAAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030649.1-408s1c1
Sequence:CCGGGCAGGCCAAGAAGAAGTTTGACTCGAGTCAAACTTCTTCTTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-636s1c1
Sequence:CCGGCGATGAGTCCAAAGTGGAGTTCTCGAGAACTCCACTTTGGACTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-196s1c1
Sequence:CCGGCAGAGCTTTGTCAAAGAGGATCTCGAGATCCTCTTTGACAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-2414s21c1
Sequence:CCGGCAACGCTGACATCGTGACACTCTCGAGAGTGTCACGATGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-751s21c1
Sequence:CCGGTGATCGACTCTGCGGTGGAAACTCGAGTTTCCACCGCAGAGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-1031s21c1
Sequence:CCGGTGTGAAGCCGTGTGAGGACATCTCGAGATGTCCTCACACGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030649.2-2867s21c1
Sequence:CCGGGCTCATGTCACAAGCCACTTTCTCGAGAAAGTGGCTTGTGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-583s21c1
Sequence:CCGGACTATGTGCTCCAGATCAATGCTCGAGCATTGATCTGGAGCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-286s21c1
Sequence:CCGGACACCGTCATCTCGGAATGTCCTCGAGGACATTCCGAGATGACGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030649
VALIDATED
ACAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-207s1c1
Sequence:CCGGCAAAGAGGATGTGCGGAAGTTCTCGAGAACTTCCGCACATCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-710s1c1
Sequence:CCGGCCAGCAACGCTTTCAAGACATCTCGAGATGTCTTGAAAGCGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-713s1c1
Sequence:CCGGGCAACGCTTTCAAGACATGGACTCGAGTCCATGTCTTGAAAGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030649.1-408s1c1
Sequence:CCGGGCAGGCCAAGAAGAAGTTTGACTCGAGTCAAACTTCTTCTTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030649.1-636s1c1
Sequence:CCGGCGATGAGTCCAAAGTGGAGTTCTCGAGAACTCCACTTTGGACTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030649.1-196s1c1
Sequence:CCGGCAGAGCTTTGTCAAAGAGGATCTCGAGATCCTCTTTGACAAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-2414s21c1
Sequence:CCGGCAACGCTGACATCGTGACACTCTCGAGAGTGTCACGATGTCAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-751s21c1
Sequence:CCGGTGATCGACTCTGCGGTGGAAACTCGAGTTTCCACCGCAGAGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-1031s21c1
Sequence:CCGGTGTGAAGCCGTGTGAGGACATCTCGAGATGTCCTCACACGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030649.2-2867s21c1
Sequence:CCGGGCTCATGTCACAAGCCACTTTCTCGAGAAAGTGGCTTGTGACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-583s21c1
Sequence:CCGGACTATGTGCTCCAGATCAATGCTCGAGCATTGATCTGGAGCACATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030649.2-286s21c1
Sequence:CCGGACACCGTCATCTCGGAATGTCCTCGAGGACATTCCGAGATGACGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks