EMAIL THIS PAGE TO A FRIEND

ACAT1

acetyl-CoA acetyltransferase 1

Synonyms: ACAT MAT T2 THIL
UniProtKB ID: P24752, B2R6H1
Gene ID:
Human(38) Summary: This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Mouse(110446) acetyl-Coenzyme A acetyltransferase 1
Rat(25014) acetyl-CoA acetyltransferase 1
Zebrafish(445290) acetyl-Coenzyme A acetyltransferase 1 (acetoacetyl Coenzyme A thiolase)
domestic cat(101088778) acetyl-CoA acetyltransferase 1
cow(511082) acetyl-CoA acetyltransferase 1
dog(489421) acetyl-CoA acetyltransferase 1
chicken(418968) acetyl-CoA acetyltransferase 1
naked mole-rat(101709659) acetyl-CoA acetyltransferase 1
domestic guinea pig(100717423) acetyl-CoA acetyltransferase 1
sheep(101104601) acetyl-CoA acetyltransferase 1
Domestic Rabbit(100009537) acetyl-CoA acetyltransferase 1
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501575 Anti-ACAT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse, bovine
ELISA, western blot pricing
SAB2501351 Anti-ACAT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse, canine
ELISA, western blot pricing
SAB2701772 Anti-acat1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA004428 Anti-ACAT1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV54278 Anti-ACAT1 antibody produced in rabbit affinity isolated antibody horse, rat, guinea pig, bovine, zebrafish, mouse, human, rabbit
western blot pricing
HPA007569 Anti-ACAT1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105925 Anti-ACAT1 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit
western blot pricing
SAB4501646 Anti-ACAT1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB1402680 Monoclonal Anti-ACAT1 antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101031 MISSION® esiRNA esiRNA human ACAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000019 Rosetta Predictions human pricing
NM_017075 Rosetta Predictions rat pricing
NM_144784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067794 predicted 597
2 SASI_Hs01_00067795 predicted 1146
3 SASI_Hs01_00067796 predicted 421
4 SASI_Hs01_00067798 predicted 332
5 SASI_Hs01_00067799 predicted 1252
6 SASI_Hs01_00067800 predicted 422
7 SASI_Hs01_00067801 predicted 679
8 SASI_Hs01_00067802 predicted 470
9 SASI_Hs01_00067803 predicted 901
10 SASI_Hs02_00301678 predicted 1027
11 SASI_Hs01_00067797 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083600 predicted 769
2 SASI_Rn01_00083601 predicted 651
3 SASI_Rn01_00083602 predicted 1002
4 SASI_Rn01_00083603 predicted 1173
5 SASI_Rn02_00261285 predicted 849
6 SASI_Rn01_00083604 predicted 1220
7 SASI_Rn01_00083605 predicted 1348
8 SASI_Rn01_00083606 predicted 473
9 SASI_Rn01_00083607 predicted 267
10 SASI_Rn01_00083608 predicted 1074
11 SASI_Rn01_00083609 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340122 predicted 460
2 SASI_Mm01_00079145 predicted 710
3 SASI_Mm01_00079146 predicted 612
4 SASI_Mm01_00079148 predicted 746
5 SASI_Mm01_00079149 predicted 1058
6 SASI_Mm01_00079150 predicted 1123
7 SASI_Mm01_00079151 predicted 528
8 SASI_Mm01_00079152 predicted 582
9 SASI_Mm01_00079153 predicted 253
10 SASI_Mm02_00340123 predicted 674
11 SASI_Mm01_00079147 predicted 1054
12 SASI_Mm01_00079154 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144784
VALIDATED
ACAT1 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acetyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1410s21c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-393s21c1
Sequence:CCGGGGGCGCAGGTTTACCTATTTCCTCGAGGAAATAGGTAAACCTGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1284s21c1
Sequence:CCGGGTTCGGTCTGGCTAGTATTTGCTCGAGCAAATACTAGCCAGACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-615s21c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1060s21c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1410s1c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144784.2-175s1c1
Sequence:CCGGCCCACTTTGAATGAAGTGGTTCTCGAGAACCACTTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-615s1c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1060s1c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-971s1c1
Sequence:CCGGAGAGGCTCAATGTTAAGCCATCTCGAGATGGCTTAACATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144784
VALIDATED
ACAT1 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acetyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1410s21c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-393s21c1
Sequence:CCGGGGGCGCAGGTTTACCTATTTCCTCGAGGAAATAGGTAAACCTGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1284s21c1
Sequence:CCGGGTTCGGTCTGGCTAGTATTTGCTCGAGCAAATACTAGCCAGACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-615s21c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1060s21c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1410s1c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144784.2-175s1c1
Sequence:CCGGCCCACTTTGAATGAAGTGGTTCTCGAGAACCACTTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-615s1c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1060s1c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-971s1c1
Sequence:CCGGAGAGGCTCAATGTTAAGCCATCTCGAGATGGCTTAACATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144784
VALIDATED
ACAT1 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acetyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1410s21c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-393s21c1
Sequence:CCGGGGGCGCAGGTTTACCTATTTCCTCGAGGAAATAGGTAAACCTGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1284s21c1
Sequence:CCGGGTTCGGTCTGGCTAGTATTTGCTCGAGCAAATACTAGCCAGACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-615s21c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144784.3-1060s21c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1410s1c1
Sequence:CCGGGCCAGGTTATATTCAGCATAACTCGAGTTATGCTGAATATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144784.2-175s1c1
Sequence:CCGGCCCACTTTGAATGAAGTGGTTCTCGAGAACCACTTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-615s1c1
Sequence:CCGGGCTAACTGATGTCTACAATAACTCGAGTTATTGTAGACATCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-1060s1c1
Sequence:CCGGGCCGTACCTAAGGTTCTTAAACTCGAGTTTAAGAACCTTAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144784.2-971s1c1
Sequence:CCGGAGAGGCTCAATGTTAAGCCATCTCGAGATGGCTTAACATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000019
VALIDATED
ACAT1 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acetyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-1139s21c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-266s21c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000019.3-698s21c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-812s21c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-698s1c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-1139s1c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-812s1c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-266s1c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-438s1c1
Sequence:CCGGCCATAAACAAAGTTTGTGCTTCTCGAGAAGCACAAACTTTGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000019
VALIDATED
ACAT1 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acetyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-1139s21c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-266s21c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000019.3-698s21c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-812s21c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-698s1c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-1139s1c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-812s1c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-266s1c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-438s1c1
Sequence:CCGGCCATAAACAAAGTTTGTGCTTCTCGAGAAGCACAAACTTTGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000019
VALIDATED
ACAT1 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acetyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-1139s21c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-266s21c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000019.3-698s21c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000019.3-812s21c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-698s1c1
Sequence:CCGGCGAAATGAACAGGACGCTTATCTCGAGATAAGCGTCCTGTTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-1139s1c1
Sequence:CCGGGCCTTTAGTCTGGTTGTACTACTCGAGTAGTACAACCAGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-812s1c1
Sequence:CCGGCCAGATGTAGTGGTGAAAGAACTCGAGTTCTTTCACCACTACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-266s1c1
Sequence:CCGGGCCACTAAGCTTGGTTCCATTCTCGAGAATGGAACCAAGCTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000019.2-438s1c1
Sequence:CCGGCCATAAACAAAGTTTGTGCTTCTCGAGAAGCACAAACTTTGTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks