EMAIL THIS PAGE TO A FRIEND

ACAT2

acetyl-CoA acetyltransferase 2

68 Gene Product Result for
UniProtKB ID: Q9BWD1, E1P5B1, Q16146, Q5TCL7, Q8TDM4
Gene ID:
Human(39) Summary: The product of this gene is an enzyme involved in lipid metabolism, and it encodes cytosolic acetoacetyl-CoA thiolase. This gene shows complementary overlapping with the 3-prime region of the TCP1 gene in both mouse and human. These genes are encoded on opposite strands of DNA, as well as in opposite transcriptional orientation. [provided by RefSeq, Jul 2008]
Mouse(110460) acetyl-Coenzyme A acetyltransferase 2
Rat(308100) acetyl-CoA acetyltransferase 2
sheep(101111975) acetyl-CoA acetyltransferase 2
domestic guinea pig(100714379) acetyl-CoA acetyltransferase 2
naked mole-rat(101712256) acetyl-CoA acetyltransferase 2
Zebrafish(30643) acetyl-CoA acetyltransferase 2
Thale Cress(834876) acetoacetyl-CoA thiolase 2
cow(512044) acetyl-CoA acetyltransferase 2
domestic cat(101093863) acetyl-CoA acetyltransferase 2
dog(484063) acetyl-CoA acetyltransferase 2
chicken(421587) acetyl-CoA acetyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5609 Anti-ACAT2 (216-230) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32790 Anti-ACAT2 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, rabbit, bovine, horse, human, mouse, guinea pig
immunohistochemistry, western blot pricing
AV32791 Anti-ACAT2 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat, guinea pig, bovine, human, horse
immunohistochemistry, western blot pricing
SAB1405418 Anti-ACAT2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA025736 Anti-ACAT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
HPA025765 Anti-ACAT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
HPA025811 Anti-ACAT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry, western blot pricing
GW22016 Anti-Acetyl-CoA Acetyltransferase 2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4100138 Monoclonal Anti-ACAT2 antibody produced in mouse clone ACAT2-A103, culture supernatant human
western blot pricing
SAB1402106 Monoclonal Anti-ACAT2 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005891 Rosetta Predictions human pricing
NM_001006995 Rosetta Predictions rat pricing
NM_009338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149720 predicted 1013
2 SASI_Hs01_00149721 predicted 818
3 SASI_Hs02_00340488 predicted 1307
4 SASI_Hs01_00149722 predicted 926
5 SASI_Hs01_00149723 predicted 1022
6 SASI_Hs01_00149724 predicted 947
7 SASI_Hs01_00149726 predicted 947
8 SASI_Hs02_00340489 predicted 1218
9 SASI_Hs01_00149727 predicted 576
10 SASI_Hs02_00340490 predicted 1245
11 SASI_Hs01_00149725 predicted 485
12 SASI_Hs01_00149728 predicted 426
13 SASI_Hs01_00149729 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198570 predicted 837
2 SASI_Rn02_00198571 predicted 683
3 SASI_Rn01_00038513 predicted 416
4 SASI_Rn02_00198572 predicted 611
5 SASI_Rn02_00198573 predicted 681
6 SASI_Rn02_00198574 predicted 1347
7 SASI_Rn02_00198575 predicted 422
8 SASI_Rn02_00198576 predicted 730
9 SASI_Rn02_00198577 predicted 294
10 SASI_Rn01_00038509 predicted 1403
11 SASI_Rn01_00038510 predicted 1384
12 SASI_Rn01_00038511 predicted 1107
13 SASI_Rn01_00038512 predicted 1230
14 SASI_Rn01_00038514 predicted 1382
15 SASI_Rn01_00038515 predicted 1349
16 SASI_Rn01_00038516 predicted 1421
17 SASI_Rn01_00038517 predicted 1333
18 SASI_Rn01_00038518 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038403 predicted 944
2 SASI_Mm01_00038404 predicted 759
3 SASI_Mm01_00038406 predicted 219
4 SASI_Mm01_00038407 predicted 1276
5 SASI_Mm01_00038408 predicted 875
6 SASI_Mm02_00315908 predicted 1272
7 SASI_Mm01_00038409 predicted 926
8 SASI_Mm01_00038410 predicted 631
9 SASI_Mm01_00038411 predicted 438
10 SASI_Mm02_00315909 predicted 589
11 SASI_Mm01_00038402 predicted 872
12 SASI_Mm01_00038405 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005891
VALIDATED
ACAT2 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acetyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-1242s1c1
Sequence:CCGGTCAGAGAGAATGAATTGCTTACTCGAGTAAGCAATTCATTCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-779s1c1
Sequence:CCGGCCAGCCAATGCTTCAGGAATACTCGAGTATTCCTGAAGCATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-932s1c1
Sequence:CCGGCCAGCCATAAAGCAAGCTGTTCTCGAGAACAGCTTGCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-821s1c1
Sequence:CCGGGCTCTTATGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005891.1-1022s1c1
Sequence:CCGGGCTGCAATAGTTAAAGAACTTCTCGAGAAGTTCTTTAACTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1141s21c1
Sequence:CCGGTAAACCCAGAGAAGGTCAATACTCGAGTATTGACCTTCTCTGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-956s21c1
Sequence:CCGGACCTTTAGCACGGATAGTTTCCTCGAGGAAACTATCCGTGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-925s21c1
Sequence:GTACCGGAGAAGTCAGAAGCTGATAAACCTCGAGGTTTATCAGCTTCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1065s21c1
Sequence:CCGGCTGGAAGATGTTGACATATTTCTCGAGAAATATGTCAACATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-826s21c1
Sequence:CCGGCCAAGCTAAAGCCTTACTTTCCTCGAGGAAAGTAAGGCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005891
VALIDATED
ACAT2 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acetyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-1242s1c1
Sequence:CCGGTCAGAGAGAATGAATTGCTTACTCGAGTAAGCAATTCATTCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-779s1c1
Sequence:CCGGCCAGCCAATGCTTCAGGAATACTCGAGTATTCCTGAAGCATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-932s1c1
Sequence:CCGGCCAGCCATAAAGCAAGCTGTTCTCGAGAACAGCTTGCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-821s1c1
Sequence:CCGGGCTCTTATGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005891.1-1022s1c1
Sequence:CCGGGCTGCAATAGTTAAAGAACTTCTCGAGAAGTTCTTTAACTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1141s21c1
Sequence:CCGGTAAACCCAGAGAAGGTCAATACTCGAGTATTGACCTTCTCTGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-956s21c1
Sequence:CCGGACCTTTAGCACGGATAGTTTCCTCGAGGAAACTATCCGTGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-925s21c1
Sequence:GTACCGGAGAAGTCAGAAGCTGATAAACCTCGAGGTTTATCAGCTTCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1065s21c1
Sequence:CCGGCTGGAAGATGTTGACATATTTCTCGAGAAATATGTCAACATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-826s21c1
Sequence:CCGGCCAAGCTAAAGCCTTACTTTCCTCGAGGAAAGTAAGGCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005891
VALIDATED
ACAT2 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acetyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-1242s1c1
Sequence:CCGGTCAGAGAGAATGAATTGCTTACTCGAGTAAGCAATTCATTCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-779s1c1
Sequence:CCGGCCAGCCAATGCTTCAGGAATACTCGAGTATTCCTGAAGCATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005891.1-932s1c1
Sequence:CCGGCCAGCCATAAAGCAAGCTGTTCTCGAGAACAGCTTGCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005891.1-821s1c1
Sequence:CCGGGCTCTTATGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005891.1-1022s1c1
Sequence:CCGGGCTGCAATAGTTAAAGAACTTCTCGAGAAGTTCTTTAACTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1141s21c1
Sequence:CCGGTAAACCCAGAGAAGGTCAATACTCGAGTATTGACCTTCTCTGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-956s21c1
Sequence:CCGGACCTTTAGCACGGATAGTTTCCTCGAGGAAACTATCCGTGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-925s21c1
Sequence:GTACCGGAGAAGTCAGAAGCTGATAAACCTCGAGGTTTATCAGCTTCTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-1065s21c1
Sequence:CCGGCTGGAAGATGTTGACATATTTCTCGAGAAATATGTCAACATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005891.2-826s21c1
Sequence:CCGGCCAAGCTAAAGCCTTACTTTCCTCGAGGAAAGTAAGGCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009338
VALIDATED
ACAT2 MISSION shRNA Bacterial Glycerol Stock
acetyl-CoA acetyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1718s21c1
Sequence:CCGGTTCGGCTTCTGTTACGAACTTCTCGAGAAGTTCGTAACAGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1792s21c1
Sequence:CCGGTCGGTTTCCCATTGATCAAATCTCGAGATTTGATCAATGGGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1481s21c1
Sequence:CCGGTTCCATGTTTATCGTCTTTACCTCGAGGTAAAGACGATAAACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1815s21c1
Sequence:CCGGAGACCAATCCTGTAGTGAAAGCTCGAGCTTTCACTACAGGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009338.3-1041s21c1
Sequence:CCGGGTGTCTGCGGCAATAGCTAAACTCGAGTTTAGCTATTGCCGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009338
VALIDATED
ACAT2 MISSION shRNA shRNA Plasmid DNA
acetyl-CoA acetyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1718s21c1
Sequence:CCGGTTCGGCTTCTGTTACGAACTTCTCGAGAAGTTCGTAACAGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1792s21c1
Sequence:CCGGTCGGTTTCCCATTGATCAAATCTCGAGATTTGATCAATGGGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1481s21c1
Sequence:CCGGTTCCATGTTTATCGTCTTTACCTCGAGGTAAAGACGATAAACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1815s21c1
Sequence:CCGGAGACCAATCCTGTAGTGAAAGCTCGAGCTTTCACTACAGGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009338.3-1041s21c1
Sequence:CCGGGTGTCTGCGGCAATAGCTAAACTCGAGTTTAGCTATTGCCGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009338
VALIDATED
ACAT2 MISSION shRNA Lentiviral Transduction Particles
acetyl-CoA acetyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1718s21c1
Sequence:CCGGTTCGGCTTCTGTTACGAACTTCTCGAGAAGTTCGTAACAGAAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1792s21c1
Sequence:CCGGTCGGTTTCCCATTGATCAAATCTCGAGATTTGATCAATGGGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1481s21c1
Sequence:CCGGTTCCATGTTTATCGTCTTTACCTCGAGGTAAAGACGATAAACATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009338.3-1815s21c1
Sequence:CCGGAGACCAATCCTGTAGTGAAAGCTCGAGCTTTCACTACAGGATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009338.3-1041s21c1
Sequence:CCGGGTGTCTGCGGCAATAGCTAAACTCGAGTTTAGCTATTGCCGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks