EMAIL THIS PAGE TO A FRIEND

ACBD3

acyl-CoA binding domain containing 3

189 Gene Product Result for
Synonyms: GCP60 GOCAP1 GOLPH1 PAP7
Gene ID:
Human(64746) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Mouse(170760) acyl-Coenzyme A binding domain containing 3
Rat(289312) acyl-CoA binding domain containing 3
naked mole-rat(101700366) acyl-CoA binding domain containing 3
domestic guinea pig(100734765) acyl-CoA binding domain containing 3
sheep(101105589) acyl-CoA binding domain containing 3
Zebrafish(406270) acyl-Coenzyme A binding domain containing 3
cow(783375) acyl-CoA binding domain containing 3
domestic cat(101086777) acyl-CoA binding domain containing 3
dog(611888) acyl-CoA binding domain containing 3
chicken(421317) acyl-CoA binding domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022735 Rosetta Predictions human pricing
NM_182843 Rosetta Predictions rat pricing
NM_133225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052488 predicted 1609
2 SASI_Hs01_00052489 predicted 1292
3 SASI_Hs01_00052490 predicted 1007
4 SASI_Hs01_00052491 predicted 1294
5 SASI_Hs01_00052492 predicted 1598
6 SASI_Hs01_00052493 predicted 1529
7 SASI_Hs01_00052495 predicted 1030
8 SASI_Hs01_00052496 predicted 1653
9 SASI_Hs02_00355973 predicted 1275
10 SASI_Hs02_00355974 predicted 1639
11 SASI_Hs01_00052494 predicted 1218
12 SASI_Hs01_00052497 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116759 predicted 1130
2 SASI_Rn01_00116760 predicted 1264
3 SASI_Rn01_00116761 predicted 1731
4 SASI_Rn01_00116762 predicted 1671
5 SASI_Rn01_00116763 predicted 1164
6 SASI_Rn01_00116764 predicted 1604
7 SASI_Rn01_00116765 predicted 1617
8 SASI_Rn01_00116766 predicted 1505
9 SASI_Rn01_00116767 predicted 1301
10 SASI_Rn02_00269857 predicted 1265
11 SASI_Rn01_00116768 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160068 predicted 1047
2 SASI_Mm01_00160070 predicted 1669
3 SASI_Mm01_00160071 predicted 1652
4 SASI_Mm01_00160072 predicted 1267
5 SASI_Mm02_00338456 predicted 954
6 SASI_Mm01_00160073 predicted 1035
7 SASI_Mm01_00160074 predicted 1611
8 SASI_Mm02_00338457 predicted 1028
9 SASI_Mm01_00160075 predicted 1673
10 SASI_Mm01_00160076 predicted 1304
11 SASI_Mm01_00160069 predicted 1172
12 SASI_Mm01_00160077 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022735
VALIDATED
ACBD3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-412s1c1
Sequence:CCGGGCCCATATAATCCAGACACTTCTCGAGAAGTGTCTGGATTATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-343s1c1
Sequence:CCGGGCAAAGCATTTCATCCAACTTCTCGAGAAGTTGGATGAAATGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-3136s1c1
Sequence:CCGGCCCAGCTCATAGGTGTTCATACTCGAGTATGAACACCTATGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-1270s1c1
Sequence:CCGGCCACCCATGAAGAAGGATCATCTCGAGATGATCCTTCTTCATGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-776s1c1
Sequence:CCGGGCAGCAGATAATGGCAGCTTTCTCGAGAAAGCTGCCATTATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-1273s21c1
Sequence:CCGGCCCATGAAGAAGGATCATATCCTCGAGGATATGATCCTTCTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-2033s21c1
Sequence:CCGGCCATAAGTTAACAAGTCTATACTCGAGTATAGACTTGTTAACTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-401s21c1
Sequence:CCGGAGTTCTTATGGGCCCATATAACTCGAGTTATATGGGCCCATAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1606s21c1
Sequence:CCGGTCTACTACAGAGTCTATTATACTCGAGTATAATAGACTCTGTAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1213s21c1
Sequence:CCGGAGGATGCAGATTCCGTGATTACTCGAGTAATCACGGAATCTGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022735
VALIDATED
ACBD3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-412s1c1
Sequence:CCGGGCCCATATAATCCAGACACTTCTCGAGAAGTGTCTGGATTATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-343s1c1
Sequence:CCGGGCAAAGCATTTCATCCAACTTCTCGAGAAGTTGGATGAAATGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-3136s1c1
Sequence:CCGGCCCAGCTCATAGGTGTTCATACTCGAGTATGAACACCTATGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-1270s1c1
Sequence:CCGGCCACCCATGAAGAAGGATCATCTCGAGATGATCCTTCTTCATGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-776s1c1
Sequence:CCGGGCAGCAGATAATGGCAGCTTTCTCGAGAAAGCTGCCATTATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-1273s21c1
Sequence:CCGGCCCATGAAGAAGGATCATATCCTCGAGGATATGATCCTTCTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-2033s21c1
Sequence:CCGGCCATAAGTTAACAAGTCTATACTCGAGTATAGACTTGTTAACTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-401s21c1
Sequence:CCGGAGTTCTTATGGGCCCATATAACTCGAGTTATATGGGCCCATAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1606s21c1
Sequence:CCGGTCTACTACAGAGTCTATTATACTCGAGTATAATAGACTCTGTAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1213s21c1
Sequence:CCGGAGGATGCAGATTCCGTGATTACTCGAGTAATCACGGAATCTGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022735
VALIDATED
ACBD3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-412s1c1
Sequence:CCGGGCCCATATAATCCAGACACTTCTCGAGAAGTGTCTGGATTATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-343s1c1
Sequence:CCGGGCAAAGCATTTCATCCAACTTCTCGAGAAGTTGGATGAAATGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-3136s1c1
Sequence:CCGGCCCAGCTCATAGGTGTTCATACTCGAGTATGAACACCTATGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022735.3-1270s1c1
Sequence:CCGGCCACCCATGAAGAAGGATCATCTCGAGATGATCCTTCTTCATGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022735.3-776s1c1
Sequence:CCGGGCAGCAGATAATGGCAGCTTTCTCGAGAAAGCTGCCATTATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-1273s21c1
Sequence:CCGGCCCATGAAGAAGGATCATATCCTCGAGGATATGATCCTTCTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022735.3-2033s21c1
Sequence:CCGGCCATAAGTTAACAAGTCTATACTCGAGTATAGACTTGTTAACTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-401s21c1
Sequence:CCGGAGTTCTTATGGGCCCATATAACTCGAGTTATATGGGCCCATAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1606s21c1
Sequence:CCGGTCTACTACAGAGTCTATTATACTCGAGTATAATAGACTCTGTAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022735.3-1213s21c1
Sequence:CCGGAGGATGCAGATTCCGTGATTACTCGAGTAATCACGGAATCTGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133225
VALIDATED
ACBD3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1721s1c1
Sequence:CCGGCCGTGTTTATCTTCTCGATTTCTCGAGAAATCGAGAAGATAAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1605s1c1
Sequence:CCGGGTCCGTCTACTACAGAGTCTACTCGAGTAGACTCTGTAGTAGACGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-955s1c1
Sequence:CCGGGCAGCATTACAGAAACAGCAACTCGAGTTGCTGTTTCTGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-1608s1c1
Sequence:CCGGCGTCTACTACAGAGTCTATTACTCGAGTAATAGACTCTGTAGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-391s1c1
Sequence:CCGGGCACTGCATAAGCAAGTTCTTCTCGAGAAGAACTTGCTTATGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133225
VALIDATED
ACBD3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1721s1c1
Sequence:CCGGCCGTGTTTATCTTCTCGATTTCTCGAGAAATCGAGAAGATAAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1605s1c1
Sequence:CCGGGTCCGTCTACTACAGAGTCTACTCGAGTAGACTCTGTAGTAGACGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-955s1c1
Sequence:CCGGGCAGCATTACAGAAACAGCAACTCGAGTTGCTGTTTCTGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-1608s1c1
Sequence:CCGGCGTCTACTACAGAGTCTATTACTCGAGTAATAGACTCTGTAGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-391s1c1
Sequence:CCGGGCACTGCATAAGCAAGTTCTTCTCGAGAAGAACTTGCTTATGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133225
VALIDATED
ACBD3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1721s1c1
Sequence:CCGGCCGTGTTTATCTTCTCGATTTCTCGAGAAATCGAGAAGATAAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133225.1-1605s1c1
Sequence:CCGGGTCCGTCTACTACAGAGTCTACTCGAGTAGACTCTGTAGTAGACGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-955s1c1
Sequence:CCGGGCAGCATTACAGAAACAGCAACTCGAGTTGCTGTTTCTGTAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-1608s1c1
Sequence:CCGGCGTCTACTACAGAGTCTATTACTCGAGTAATAGACTCTGTAGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133225.1-391s1c1
Sequence:CCGGGCACTGCATAAGCAAGTTCTTCTCGAGAAGAACTTGCTTATGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)