EMAIL THIS PAGE TO A FRIEND

ACBD4

acyl-CoA binding domain containing 4

UniProtKB ID: Q8NC06, D3DX64, Q8IUT1, Q9H8Q4
Gene ID:
Human(79777) Summary: This gene encodes a member of the acyl-coenzyme A binding domain containing protein family. All family members contain the conserved acyl-Coenzyme A binding domain, which binds acyl-CoA thiol esters. They are thought to play roles in acyl-CoA dependent lipid metabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(67131) acyl-Coenzyme A binding domain containing 4
Rat(303577) acyl-CoA binding domain containing 4
Zebrafish(406368) acyl-CoA binding domain containing 4
dog(490928) acyl-CoA binding domain containing 4
domestic cat(101082959) acyl-CoA binding domain containing 4
cow(515848) acyl-CoA binding domain containing 4
sheep(101118970) acyl-CoA binding domain containing 4
domestic guinea pig(100724636) acyl-CoA binding domain containing 4
naked mole-rat(101704271) acyl-CoA binding domain containing 4
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024722 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024722 Rosetta Predictions human pricing
NM_001012013 Rosetta Predictions rat pricing
XM_573203 Rosetta Predictions rat pricing
NM_001081495 Rosetta Predictions mouse pricing
NM_025988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096124 predicted 573
2 SASI_Hs01_00096125 predicted 669
3 SASI_Hs01_00096126 predicted 713
4 SASI_Hs01_00096128 predicted 1725
5 SASI_Hs01_00096130 predicted 1435
6 SASI_Hs01_00096131 predicted 848
7 SASI_Hs01_00096132 predicted 1467
8 SASI_Hs01_00096133 predicted 777
9 SASI_Hs02_00357193 predicted 741
10 SASI_Hs02_00357194 predicted 1601
11 SASI_Hs01_00096127 predicted 1682
12 SASI_Hs01_00096129 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059638 predicted 398
2 SASI_Rn02_00200094 predicted 385
3 SASI_Rn01_00059640 predicted 1416
4 SASI_Rn01_00059641 predicted 660
5 SASI_Rn01_00059642 predicted 526
6 SASI_Rn01_00059643 predicted 1217
7 SASI_Rn01_00059644 predicted 877
8 SASI_Rn01_00059645 predicted 1524
9 SASI_Rn01_00059646 predicted 332
10 SASI_Rn01_00059647 predicted 395
11 SASI_Rn01_00059639 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139693 predicted 399
2 SASI_Rn01_00139694 predicted 664
3 SASI_Rn01_00139695 predicted 1419
4 SASI_Rn01_00139696 predicted 666
5 SASI_Rn01_00139697 predicted 533
6 SASI_Rn01_00139698 predicted 1218
7 SASI_Rn01_00139699 predicted 881
8 SASI_Rn01_00139700 predicted 1531
9 SASI_Rn01_00139701 predicted 332
10 SASI_Rn01_00139702 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298630 predicted 1633
2 SASI_Mm02_00298631 predicted 1623
3 SASI_Mm02_00298632 predicted 1624
4 SASI_Mm02_00298633 predicted 1076
5 SASI_Mm02_00298634 predicted 1171
6 SASI_Mm02_00298635 predicted 1358
7 SASI_Mm02_00298636 predicted 955
8 SASI_Mm02_00298637 predicted 1402
9 SASI_Mm02_00298638 predicted 1152
10 SASI_Mm02_00298639 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329435 predicted 1755
2 SASI_Mm01_00124419 predicted 1750
3 SASI_Mm02_00329436 predicted 1746
4 SASI_Mm02_00329437 predicted 1198
5 SASI_Mm01_00124425 predicted 1293
6 SASI_Mm01_00124426 predicted 1487
7 SASI_Mm01_00124427 predicted 1081
8 SASI_Mm02_00329438 predicted 1525
9 SASI_Mm02_00329439 predicted 1287
10 SASI_Mm02_00329440 predicted 1547
11 SASI_Mm01_00124420 predicted 574
12 SASI_Mm01_00124421 predicted 575
13 SASI_Mm01_00124422 predicted 724
14 SASI_Mm01_00124423 predicted 721
15 SASI_Mm01_00124424 predicted 711
16 SASI_Mm01_00124428 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024722
ACBD4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1397s1c1
Sequence:CCGGGCAGCCAACTGAGACTATCTTCTCGAGAAGATAGTCTCAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-567s1c1
Sequence:CCGGGAAGAGATGCTGCGATTCTACCTCGAGGTAGAATCGCAGCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-710s1c1
Sequence:CCGGCATGTCTGCCTACATCACTGACTCGAGTCAGTGATGTAGGCAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1740s1c1
Sequence:CCGGCTCTTGAGCAAGTTGGGACTTCTCGAGAAGTCCCAACTTGCTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-874s1c1
Sequence:CCGGGTTGGAAAGAGCAGGTTGTGACTCGAGTCACAACCTGCTCTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-1338s1c1
Sequence:CCGGCAGTGGCTCTTCCGAATGTTTCTCGAGAAACATTCGGAAGAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1400s1c1
Sequence:CCGGGCCAACTGAGACTATCTTGCTCTCGAGAGCAAGATAGTCTCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-562s1c1
Sequence:CCGGCCTATGAAGAGATGCTGCGATCTCGAGATCGCAGCATCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1441s1c1
Sequence:CCGGGTTTAGAAGAACAGCATTCAACTCGAGTTGAATGCTGTTCTTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-533s1c1
Sequence:CCGGCCTGCCCAAGAACGGTTCTTACTCGAGTAAGAACCGTTCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-717s1c1
Sequence:CCGGGCCTACATCACTGAAATGAAACTCGAGTTTCATTTCAGTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-722s1c1
Sequence:CCGGCATCACTGAAATGAAACTGGTCTCGAGACCAGTTTCATTTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-578s1c1
Sequence:CCGGGCGATTCTACAGTTACTACAACTCGAGTTGTAGTAACTGTAGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024722
ACBD4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1397s1c1
Sequence:CCGGGCAGCCAACTGAGACTATCTTCTCGAGAAGATAGTCTCAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-567s1c1
Sequence:CCGGGAAGAGATGCTGCGATTCTACCTCGAGGTAGAATCGCAGCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-710s1c1
Sequence:CCGGCATGTCTGCCTACATCACTGACTCGAGTCAGTGATGTAGGCAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1740s1c1
Sequence:CCGGCTCTTGAGCAAGTTGGGACTTCTCGAGAAGTCCCAACTTGCTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-874s1c1
Sequence:CCGGGTTGGAAAGAGCAGGTTGTGACTCGAGTCACAACCTGCTCTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-1338s1c1
Sequence:CCGGCAGTGGCTCTTCCGAATGTTTCTCGAGAAACATTCGGAAGAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1400s1c1
Sequence:CCGGGCCAACTGAGACTATCTTGCTCTCGAGAGCAAGATAGTCTCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-562s1c1
Sequence:CCGGCCTATGAAGAGATGCTGCGATCTCGAGATCGCAGCATCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1441s1c1
Sequence:CCGGGTTTAGAAGAACAGCATTCAACTCGAGTTGAATGCTGTTCTTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-533s1c1
Sequence:CCGGCCTGCCCAAGAACGGTTCTTACTCGAGTAAGAACCGTTCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-717s1c1
Sequence:CCGGGCCTACATCACTGAAATGAAACTCGAGTTTCATTTCAGTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-722s1c1
Sequence:CCGGCATCACTGAAATGAAACTGGTCTCGAGACCAGTTTCATTTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-578s1c1
Sequence:CCGGGCGATTCTACAGTTACTACAACTCGAGTTGTAGTAACTGTAGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024722
ACBD4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1397s1c1
Sequence:CCGGGCAGCCAACTGAGACTATCTTCTCGAGAAGATAGTCTCAGTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-567s1c1
Sequence:CCGGGAAGAGATGCTGCGATTCTACCTCGAGGTAGAATCGCAGCATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-710s1c1
Sequence:CCGGCATGTCTGCCTACATCACTGACTCGAGTCAGTGATGTAGGCAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024722.1-1740s1c1
Sequence:CCGGCTCTTGAGCAAGTTGGGACTTCTCGAGAAGTCCCAACTTGCTCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-874s1c1
Sequence:CCGGGTTGGAAAGAGCAGGTTGTGACTCGAGTCACAACCTGCTCTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-1338s1c1
Sequence:CCGGCAGTGGCTCTTCCGAATGTTTCTCGAGAAACATTCGGAAGAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140697    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1400s1c1
Sequence:CCGGGCCAACTGAGACTATCTTGCTCTCGAGAGCAAGATAGTCTCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-562s1c1
Sequence:CCGGCCTATGAAGAGATGCTGCGATCTCGAGATCGCAGCATCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024722.1-1441s1c1
Sequence:CCGGGTTTAGAAGAACAGCATTCAACTCGAGTTGAATGCTGTTCTTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024722.1-533s1c1
Sequence:CCGGCCTGCCCAAGAACGGTTCTTACTCGAGTAAGAACCGTTCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-717s1c1
Sequence:CCGGGCCTACATCACTGAAATGAAACTCGAGTTTCATTTCAGTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-722s1c1
Sequence:CCGGCATCACTGAAATGAAACTGGTCTCGAGACCAGTTTCATTTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024722.1-578s1c1
Sequence:CCGGGCGATTCTACAGTTACTACAACTCGAGTTGTAGTAACTGTAGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025988
ACBD4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025988.1-1610s1c1
Sequence:CCGGGCTCCCATAAGACCCATCTTTCTCGAGAAAGATGGGTCTTATGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-716s1c1
Sequence:CCGGGTCTGCCTACATCTCTGAGATCTCGAGATCTCAGAGATGTAGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-578s1c1
Sequence:CCGGGCTGCGATTCTACAGCTACTACTCGAGTAGTAGCTGTAGAATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-1269s1c1
Sequence:CCGGCAGGAAAGCATGAAGGACGTTCTCGAGAACGTCCTTCATGCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-786s1c1
Sequence:CCGGGCAGAGGATATGTTTGGTTATCTCGAGATAACCAAACATATCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025988
ACBD4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025988.1-1610s1c1
Sequence:CCGGGCTCCCATAAGACCCATCTTTCTCGAGAAAGATGGGTCTTATGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-716s1c1
Sequence:CCGGGTCTGCCTACATCTCTGAGATCTCGAGATCTCAGAGATGTAGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-578s1c1
Sequence:CCGGGCTGCGATTCTACAGCTACTACTCGAGTAGTAGCTGTAGAATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-1269s1c1
Sequence:CCGGCAGGAAAGCATGAAGGACGTTCTCGAGAACGTCCTTCATGCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-786s1c1
Sequence:CCGGGCAGAGGATATGTTTGGTTATCTCGAGATAACCAAACATATCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025988
ACBD4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025988.1-1610s1c1
Sequence:CCGGGCTCCCATAAGACCCATCTTTCTCGAGAAAGATGGGTCTTATGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-716s1c1
Sequence:CCGGGTCTGCCTACATCTCTGAGATCTCGAGATCTCAGAGATGTAGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-578s1c1
Sequence:CCGGGCTGCGATTCTACAGCTACTACTCGAGTAGTAGCTGTAGAATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-1269s1c1
Sequence:CCGGCAGGAAAGCATGAAGGACGTTCTCGAGAACGTCCTTCATGCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025988.1-786s1c1
Sequence:CCGGGCAGAGGATATGTTTGGTTATCTCGAGATAACCAAACATATCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks