EMAIL THIS PAGE TO A FRIEND

ACBD5

acyl-CoA binding domain containing 5

222 Gene Product Result for
Gene ID:
Human(91452) Summary: This gene encodes a member of the acyl-Coenzyme A binding protein family, known to function in the transport and distribution of long chain acyl-Coenzyme A in cells. This gene may play a role in the differentiation of megakaryocytes and formation of platelets. A mutation in this gene has been associated with autosomal dominant thrombocytopenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Mouse(74159) acyl-Coenzyme A binding domain containing 5
Rat(307170) acyl-CoA binding domain containing 5
naked mole-rat(101723891) acyl-CoA binding domain containing 5
domestic guinea pig(100728171) acyl-CoA binding domain containing 5
sheep(101119491) acyl-CoA binding domain containing 5
chicken(420488) acyl-CoA binding domain containing 5
cow(353160) acyl-CoA binding domain containing 5
domestic cat(101083347) acyl-CoA binding domain containing 5
Horse(100055334) acyl-CoA binding domain containing 5
dog(477987) acyl-CoA binding domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042473 Rosetta Predictions human pricing
NM_145698 Rosetta Predictions human pricing
NM_001077635 Rosetta Predictions rat pricing
NM_001102436 Rosetta Predictions mouse pricing
NM_001102437 Rosetta Predictions mouse pricing
NM_001102438 Rosetta Predictions mouse pricing
NM_028793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310008 predicted 1223
2 SASI_Hs02_00310009 predicted 946
3 SASI_Hs02_00310010 predicted 442
4 SASI_Hs02_00310011 predicted 1016
5 SASI_Hs02_00310012 predicted 1103
6 SASI_Hs02_00310013 predicted 1529
7 SASI_Hs02_00310014 predicted 731
8 SASI_Hs02_00310015 predicted 1071
9 SASI_Hs02_00310016 predicted 1683
10 SASI_Hs02_00310017 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365308 predicted 1308
2 SASI_Hs01_00011928 predicted 1032
3 SASI_Hs01_00011929 predicted 532
4 SASI_Hs01_00011930 predicted 1100
5 SASI_Hs01_00011931 predicted 1185
6 SASI_Hs01_00011932 predicted 1615
7 SASI_Hs01_00011933 predicted 817
8 SASI_Hs01_00011935 predicted 1162
9 SASI_Hs01_00011936 predicted 1774
10 SASI_Hs01_00011937 predicted 479
11 SASI_Hs01_00011934 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207622 predicted 870
2 SASI_Rn02_00207623 predicted 878
3 SASI_Rn02_00207624 predicted 1109
4 SASI_Rn02_00207625 predicted 1141
5 SASI_Rn02_00207626 predicted 387
6 SASI_Rn02_00207627 predicted 777
7 SASI_Rn02_00207628 predicted 330
8 SASI_Rn02_00207629 predicted 392
9 SASI_Rn02_00207630 predicted 644
10 SASI_Rn02_00207631 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302813 predicted 928
2 SASI_Mm02_00302814 predicted 933
3 SASI_Mm02_00302815 predicted 738
4 SASI_Mm02_00302816 predicted 959
5 SASI_Mm02_00302817 predicted 411
6 SASI_Mm02_00302818 predicted 764
7 SASI_Mm02_00302819 predicted 727
8 SASI_Mm02_00302820 predicted 307
9 SASI_Mm02_00302821 predicted 478
10 SASI_Mm02_00302822 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302823 predicted 1055
2 SASI_Mm02_00302824 predicted 1062
3 SASI_Mm02_00302825 predicted 865
4 SASI_Mm02_00302826 predicted 1084
5 SASI_Mm02_00302827 predicted 537
6 SASI_Mm02_00302828 predicted 888
7 SASI_Mm02_00302829 predicted 858
8 SASI_Mm02_00302830 predicted 439
9 SASI_Mm02_00302831 predicted 606
10 SASI_Mm02_00302832 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302833 predicted 1053
2 SASI_Mm02_00302834 predicted 1056
3 SASI_Mm02_00302835 predicted 868
4 SASI_Mm02_00302836 predicted 1086
5 SASI_Mm02_00302837 predicted 535
6 SASI_Mm02_00302838 predicted 895
7 SASI_Mm02_00302839 predicted 861
8 SASI_Mm02_00302840 predicted 436
9 SASI_Mm02_00302841 predicted 606
10 SASI_Mm02_00302842 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028023 predicted 927
2 SASI_Mm01_00028025 predicted 929
3 SASI_Mm01_00028026 predicted 740
4 SASI_Mm01_00028027 predicted 960
5 SASI_Mm01_00028029 predicted 411
6 SASI_Mm01_00028030 predicted 761
7 SASI_Mm02_00334402 predicted 728
8 SASI_Mm01_00028031 predicted 305
9 SASI_Mm01_00028032 predicted 476
10 SASI_Mm02_00334403 predicted 1457
11 SASI_Mm01_00028024 predicted 1351
12 SASI_Mm01_00028028 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028793
VALIDATED
ACBD5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.1-197s1c1
Sequence:CCGGGATGCTTAAGTTCTATAGCTTCTCGAGAAGCTATAGAACTTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-353s1c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-255s1c1
Sequence:CCGGGGATCATTCCAACCAACAAATCTCGAGATTTGTTGGTTGGAATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028793.3-353s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1850s21c1
Sequence:CCGGTTGAGCTTGAAGGACTAAATTCTCGAGAATTTAGTCCTTCAAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1425s21c1
Sequence:CCGGACTGCTTCGCAGGCGAAATTACTCGAGTAATTTCGCCTGCGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-744s21c1
Sequence:CCGGATTGTTACCAATGGCTATAAACTCGAGTTTATAGCCATTGGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1349s21c1
Sequence:CCGGGATCGCTCTTGTGCTCATTAGCTCGAGCTAATGAGCACAAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028793
VALIDATED
ACBD5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.1-197s1c1
Sequence:CCGGGATGCTTAAGTTCTATAGCTTCTCGAGAAGCTATAGAACTTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-353s1c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-255s1c1
Sequence:CCGGGGATCATTCCAACCAACAAATCTCGAGATTTGTTGGTTGGAATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028793.3-353s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1850s21c1
Sequence:CCGGTTGAGCTTGAAGGACTAAATTCTCGAGAATTTAGTCCTTCAAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1425s21c1
Sequence:CCGGACTGCTTCGCAGGCGAAATTACTCGAGTAATTTCGCCTGCGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-744s21c1
Sequence:CCGGATTGTTACCAATGGCTATAAACTCGAGTTTATAGCCATTGGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1349s21c1
Sequence:CCGGGATCGCTCTTGTGCTCATTAGCTCGAGCTAATGAGCACAAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028793
VALIDATED
ACBD5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.1-197s1c1
Sequence:CCGGGATGCTTAAGTTCTATAGCTTCTCGAGAAGCTATAGAACTTAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-353s1c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028793.3-255s1c1
Sequence:CCGGGGATCATTCCAACCAACAAATCTCGAGATTTGTTGGTTGGAATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028793.3-353s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1850s21c1
Sequence:CCGGTTGAGCTTGAAGGACTAAATTCTCGAGAATTTAGTCCTTCAAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1425s21c1
Sequence:CCGGACTGCTTCGCAGGCGAAATTACTCGAGTAATTTCGCCTGCGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-744s21c1
Sequence:CCGGATTGTTACCAATGGCTATAAACTCGAGTTTATAGCCATTGGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028793.3-1349s21c1
Sequence:CCGGGATCGCTCTTGTGCTCATTAGCTCGAGCTAATGAGCACAAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145698
VALIDATED
ACBD5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1928s1c1
Sequence:CCGGCCCTTGAACTTGAAGGACATTCTCGAGAATGTCCTTCAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-906s1c1
Sequence:CCGGGCTGTTTGCATTCACCAAGATCTCGAGATCTTGGTGAATGCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1620s1c1
Sequence:CCGGGCACAGTGGTTGGTGTATTTACTCGAGTAAATACACCAACCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1026s1c1
Sequence:CCGGGAAGAGTCTTTAGACAGCTTTCTCGAGAAAGCTGTCTAAAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-625s1c1
Sequence:CCGGCCGTTAATGGTAAAGCTGAAACTCGAGTTTCAGCTTTACCATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-470s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1166s21c1
Sequence:CCGGGTATTACTTGGGTGGTCATTCCTCGAGGAATGACCACCCAAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1095s21c1
Sequence:CCGGTGTGATTCTATGGAACAATTTCTCGAGAAATTGTTCCATAGAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-672s21c1
Sequence:CCGGATAACCTCAGATCTTGGTAATCTCGAGATTACCAAGATCTGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145698
VALIDATED
ACBD5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1928s1c1
Sequence:CCGGCCCTTGAACTTGAAGGACATTCTCGAGAATGTCCTTCAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-906s1c1
Sequence:CCGGGCTGTTTGCATTCACCAAGATCTCGAGATCTTGGTGAATGCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1620s1c1
Sequence:CCGGGCACAGTGGTTGGTGTATTTACTCGAGTAAATACACCAACCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1026s1c1
Sequence:CCGGGAAGAGTCTTTAGACAGCTTTCTCGAGAAAGCTGTCTAAAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-625s1c1
Sequence:CCGGCCGTTAATGGTAAAGCTGAAACTCGAGTTTCAGCTTTACCATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-470s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1166s21c1
Sequence:CCGGGTATTACTTGGGTGGTCATTCCTCGAGGAATGACCACCCAAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1095s21c1
Sequence:CCGGTGTGATTCTATGGAACAATTTCTCGAGAAATTGTTCCATAGAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-672s21c1
Sequence:CCGGATAACCTCAGATCTTGGTAATCTCGAGATTACCAAGATCTGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145698
VALIDATED
ACBD5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1928s1c1
Sequence:CCGGCCCTTGAACTTGAAGGACATTCTCGAGAATGTCCTTCAAGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-906s1c1
Sequence:CCGGGCTGTTTGCATTCACCAAGATCTCGAGATCTTGGTGAATGCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1620s1c1
Sequence:CCGGGCACAGTGGTTGGTGTATTTACTCGAGTAAATACACCAACCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-1026s1c1
Sequence:CCGGGAAGAGTCTTTAGACAGCTTTCTCGAGAAAGCTGTCTAAAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145698.1-625s1c1
Sequence:CCGGCCGTTAATGGTAAAGCTGAAACTCGAGTTTCAGCTTTACCATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-470s21c1
Sequence:CCGGGGATCCTATTGGAAGATATAACTCGAGTTATATCTTCCAATAGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1166s21c1
Sequence:CCGGGTATTACTTGGGTGGTCATTCCTCGAGGAATGACCACCCAAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-1095s21c1
Sequence:CCGGTGTGATTCTATGGAACAATTTCTCGAGAAATTGTTCCATAGAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145698.3-672s21c1
Sequence:CCGGATAACCTCAGATCTTGGTAATCTCGAGATTACCAAGATCTGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks