EMAIL THIS PAGE TO A FRIEND

ACBD6

acyl-CoA binding domain containing 6

69 Gene Product Result for
UniProtKB ID: Q9BR61
Gene ID:
Mouse(72482) acyl-Coenzyme A binding domain containing 6
Rat(289125) acyl-CoA binding domain containing 6
Zebrafish(324090) acyl-Coenzyme A binding domain containing 6
domestic cat(101095072) acyl-CoA binding domain containing 6
cow(618245) acyl-CoA binding domain containing 6
dog(480029) acyl-CoA binding domain containing 6
chicken(424416) acyl-CoA binding domain containing 6
sheep(101123137) acyl-CoA binding domain containing 6
domestic guinea pig(100727052) acyl-CoA binding domain containing 6
naked mole-rat(101726173) acyl-CoA binding domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027321 MISSION® esiRNA esiRNA human ACBD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032360 Rosetta Predictions human pricing
NM_001011906 Rosetta Predictions rat pricing
XM_573481 Rosetta Predictions rat pricing
NM_028250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077478 predicted 400
2 SASI_Hs01_00077479 predicted 410
3 SASI_Hs01_00077480 predicted 364
4 SASI_Hs01_00077483 predicted 372
5 SASI_Hs01_00077484 predicted 594
6 SASI_Hs01_00077485 predicted 587
7 SASI_Hs01_00077486 predicted 302
8 SASI_Hs02_00359746 predicted 505
9 SASI_Hs02_00359747 predicted 283
10 SASI_Hs01_00077481 predicted 404
11 SASI_Hs01_00077482 predicted 296
12 SASI_Hs01_00077487 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121058 predicted 909
2 SASI_Rn01_00121059 predicted 706
3 SASI_Rn01_00121060 predicted 1144
4 SASI_Rn01_00121061 predicted 815
5 SASI_Rn01_00121062 predicted 789
6 SASI_Rn01_00121064 predicted 1147
7 SASI_Rn01_00121065 predicted 1127
8 SASI_Rn01_00121066 predicted 1136
9 SASI_Rn01_00121067 predicted 871
10 SASI_Rn02_00199898 predicted 831
11 SASI_Rn01_00121063 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125132 predicted 915
2 SASI_Rn01_00125133 predicted 706
3 SASI_Rn01_00125134 predicted 1151
4 SASI_Rn01_00125135 predicted 821
5 SASI_Rn01_00125136 predicted 795
6 SASI_Rn01_00125137 predicted 1110
7 SASI_Rn01_00125138 predicted 1153
8 SASI_Rn01_00125139 predicted 1131
9 SASI_Rn01_00125140 predicted 1143
10 SASI_Rn01_00125141 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124919 predicted 932
2 SASI_Mm01_00124920 predicted 1150
3 SASI_Mm01_00124921 predicted 1148
4 SASI_Mm02_00333610 predicted 1048
5 SASI_Mm01_00124923 predicted 883
6 SASI_Mm02_00333611 predicted 932
7 SASI_Mm01_00124926 predicted 1053
8 SASI_Mm02_00333612 predicted 1144
9 SASI_Mm02_00333613 predicted 629
10 SASI_Mm02_00333614 predicted 1153
11 SASI_Mm01_00124917 predicted 726
12 SASI_Mm01_00124918 predicted 831
13 SASI_Mm01_00124922 predicted 737
14 SASI_Mm01_00124924 predicted 842
15 SASI_Mm01_00124925 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028250
VALIDATED
ACBD6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-878s21c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-833s21c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-1060s21c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-930s21c1
Sequence:CCGGTTTCGGTGGTCCGGTTGTTAGCTCGAGCTAACAACCGGACCACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-1147s21c1
Sequence:CCGGCAGTATGAAGCTGGCATTAATCTCGAGATTAATGCCAGCTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.2-1034s1c1
Sequence:CCGGCCAAAGCCATCAAATCGAAAGCTCGAGCTTTCGATTTGATGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-879s1c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-831s1c1
Sequence:CCGGCTAGCCAAGCAATGCAGGAATCTCGAGATTCCTGCATTGCTTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.1-1144s1c1
Sequence:CCGGGCTACAGTATGAAGCTGGCATCTCGAGATGCCAGCTTCATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-1058s1c1
Sequence:CCGGGCGGATGTGAATATGACAGATCTCGAGATCTGTCATATTCACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-1061s1c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-834s1c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028250
VALIDATED
ACBD6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-878s21c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-833s21c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-1060s21c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-930s21c1
Sequence:CCGGTTTCGGTGGTCCGGTTGTTAGCTCGAGCTAACAACCGGACCACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-1147s21c1
Sequence:CCGGCAGTATGAAGCTGGCATTAATCTCGAGATTAATGCCAGCTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.2-1034s1c1
Sequence:CCGGCCAAAGCCATCAAATCGAAAGCTCGAGCTTTCGATTTGATGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-879s1c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-831s1c1
Sequence:CCGGCTAGCCAAGCAATGCAGGAATCTCGAGATTCCTGCATTGCTTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.1-1144s1c1
Sequence:CCGGGCTACAGTATGAAGCTGGCATCTCGAGATGCCAGCTTCATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-1058s1c1
Sequence:CCGGGCGGATGTGAATATGACAGATCTCGAGATCTGTCATATTCACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-1061s1c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-834s1c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028250
VALIDATED
ACBD6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-878s21c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-833s21c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028250.2-1060s21c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-930s21c1
Sequence:CCGGTTTCGGTGGTCCGGTTGTTAGCTCGAGCTAACAACCGGACCACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028250.2-1147s21c1
Sequence:CCGGCAGTATGAAGCTGGCATTAATCTCGAGATTAATGCCAGCTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.2-1034s1c1
Sequence:CCGGCCAAAGCCATCAAATCGAAAGCTCGAGCTTTCGATTTGATGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-879s1c1
Sequence:CCGGCAGGATGGAATCCTCAGGTATCTCGAGATACCTGAGGATTCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-831s1c1
Sequence:CCGGCTAGCCAAGCAATGCAGGAATCTCGAGATTCCTGCATTGCTTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028250.1-1144s1c1
Sequence:CCGGGCTACAGTATGAAGCTGGCATCTCGAGATGCCAGCTTCATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028250.1-1058s1c1
Sequence:CCGGGCGGATGTGAATATGACAGATCTCGAGATCTGTCATATTCACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-1061s1c1
Sequence:CCGGGATGTGAATATGACAGATGAACTCGAGTTCATCTGTCATATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028250.1-834s1c1
Sequence:CCGGGCCAAGCAATGCAGGAATATACTCGAGTATATTCCTGCATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032360
VALIDATED
ACBD6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-445s1c1
Sequence:CCGGCCAGGTTGGAATCCTCAGATACTCGAGTATCTGAGGATTCCAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-739s1c1
Sequence:CCGGCAGGACAATGAAGGCCAAACACTCGAGTGTTTGGCCTTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-700s1c1
Sequence:CCGGGTCACAGTGTTGCTGCAACATCTCGAGATGTTGCAGCAACACTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-778s1c1
Sequence:CCGGGCCTGTGAGTTTCTGGATATTCTCGAGAATATCCAGAAACTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-411s1c1
Sequence:CCGGGCAGGAATATATCGCAGTAGTCTCGAGACTACTGCGATATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-325s1c1
Sequence:CCGGCCTAAACCAAGCTTCTTTGATCTCGAGATCAAAGAAGCTTGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-462s1c1
Sequence:CCGGGATACCAGAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-594s1c1
Sequence:CCGGCCATATAACCAAAGCCATCAACTCGAGTTGATGGCTTTGGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-532s1c1
Sequence:CCGGGAAGAAACCATCAGGGAAGAACTCGAGTTCTTCCCTGATGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-679s1c1
Sequence:CCGGGATCGAGGACATAAGGAACTACTCGAGTAGTTCCTTATGTCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-370s1c1
Sequence:CCGGGCTTGGAAAGCACTTGGTGATCTCGAGATCACCAAGTGCTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-711s1c1
Sequence:CCGGGCTGCAACATAGAGCTGACATCTCGAGATGTCAGCTCTATGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032360
VALIDATED
ACBD6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-445s1c1
Sequence:CCGGCCAGGTTGGAATCCTCAGATACTCGAGTATCTGAGGATTCCAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-739s1c1
Sequence:CCGGCAGGACAATGAAGGCCAAACACTCGAGTGTTTGGCCTTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-700s1c1
Sequence:CCGGGTCACAGTGTTGCTGCAACATCTCGAGATGTTGCAGCAACACTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-778s1c1
Sequence:CCGGGCCTGTGAGTTTCTGGATATTCTCGAGAATATCCAGAAACTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-411s1c1
Sequence:CCGGGCAGGAATATATCGCAGTAGTCTCGAGACTACTGCGATATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-325s1c1
Sequence:CCGGCCTAAACCAAGCTTCTTTGATCTCGAGATCAAAGAAGCTTGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-462s1c1
Sequence:CCGGGATACCAGAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-594s1c1
Sequence:CCGGCCATATAACCAAAGCCATCAACTCGAGTTGATGGCTTTGGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-532s1c1
Sequence:CCGGGAAGAAACCATCAGGGAAGAACTCGAGTTCTTCCCTGATGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-679s1c1
Sequence:CCGGGATCGAGGACATAAGGAACTACTCGAGTAGTTCCTTATGTCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-370s1c1
Sequence:CCGGGCTTGGAAAGCACTTGGTGATCTCGAGATCACCAAGTGCTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-711s1c1
Sequence:CCGGGCTGCAACATAGAGCTGACATCTCGAGATGTCAGCTCTATGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032360
VALIDATED
ACBD6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-445s1c1
Sequence:CCGGCCAGGTTGGAATCCTCAGATACTCGAGTATCTGAGGATTCCAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-739s1c1
Sequence:CCGGCAGGACAATGAAGGCCAAACACTCGAGTGTTTGGCCTTCATTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-700s1c1
Sequence:CCGGGTCACAGTGTTGCTGCAACATCTCGAGATGTTGCAGCAACACTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-778s1c1
Sequence:CCGGGCCTGTGAGTTTCTGGATATTCTCGAGAATATCCAGAAACTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-411s1c1
Sequence:CCGGGCAGGAATATATCGCAGTAGTCTCGAGACTACTGCGATATATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-325s1c1
Sequence:CCGGCCTAAACCAAGCTTCTTTGATCTCGAGATCAAAGAAGCTTGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-462s1c1
Sequence:CCGGGATACCAGAGAAGAAAGGAAACTCGAGTTTCCTTTCTTCTCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-594s1c1
Sequence:CCGGCCATATAACCAAAGCCATCAACTCGAGTTGATGGCTTTGGTTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032360.2-532s1c1
Sequence:CCGGGAAGAAACCATCAGGGAAGAACTCGAGTTCTTCCCTGATGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032360.2-679s1c1
Sequence:CCGGGATCGAGGACATAAGGAACTACTCGAGTAGTTCCTTATGTCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032360.2-370s1c1
Sequence:CCGGGCTTGGAAAGCACTTGGTGATCTCGAGATCACCAAGTGCTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032360.2-711s1c1
Sequence:CCGGGCTGCAACATAGAGCTGACATCTCGAGATGTCAGCTCTATGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks