EMAIL THIS PAGE TO A FRIEND

ACBD7

acyl-CoA binding domain containing 7

60 Gene Product Result for
Synonyms: bA455B2.2
UniProtKB ID: Q8N6N7, A6NCI2, B3KTG8
Gene ID:
Mouse(78245) acyl-Coenzyme A binding domain containing 7
Rat(361277) acyl-CoA binding domain containing 7
naked mole-rat(101696333) acyl-CoA binding domain containing 7
domestic guinea pig(100728932) acyl-CoA binding domain containing 7
Zebrafish(619256) acyl-Coenzyme A binding domain containing 7
cow(508284) acyl-CoA binding domain containing 7
domestic cat(101090024) acyl-CoA binding domain containing 7
dog(607198) acyl-CoA binding domain containing 7
chicken(420531) acyl-CoA binding domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039844 Rosetta Predictions human pricing
NM_001126079 Rosetta Predictions rat pricing
NM_030063 Rosetta Predictions mouse pricing
XM_484966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030862 predicted 216
2 SASI_Hs01_00030863 predicted 256
3 SASI_Hs01_00030864 predicted 253
4 SASI_Hs01_00030865 predicted 247
5 SASI_Hs01_00030866 predicted 255
6 SASI_Hs01_00030868 predicted 264
7 SASI_Hs02_00308684 predicted 217
8 SASI_Hs01_00030869 predicted 259
9 SASI_Hs01_00030870 predicted 266
10 SASI_Hs01_00030871 predicted 250
11 SASI_Hs01_00030867 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252803 predicted 496
2 SASI_Rn02_00252804 predicted 339
3 SASI_Rn02_00252805 predicted 258
4 SASI_Rn02_00252806 predicted 500
5 SASI_Rn02_00252807 predicted 118
6 SASI_Rn02_00252808 predicted 180
7 SASI_Rn02_00252809 predicted 410
8 SASI_Rn02_00252810 predicted 342
9 SASI_Rn02_00252811 predicted 132
10 SASI_Rn02_00252812 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336433 predicted 256
2 SASI_Mm02_00336434 predicted 247
3 SASI_Mm02_00336435 predicted 301
4 SASI_Mm02_00336436 predicted 246
5 SASI_Mm02_00336437 predicted 303
6 SASI_Mm02_00336438 predicted 206
7 SASI_Mm02_00336439 predicted 299
8 SASI_Mm02_00336440 predicted 253
9 SASI_Mm02_00336441 predicted 277
10 SASI_Mm02_00336442 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240041 predicted 261
2 SASI_Mm01_00240042 predicted 250
3 SASI_Mm01_00240043 predicted 298
4 SASI_Mm01_00240044 predicted 257
5 SASI_Mm01_00240045 predicted 306
6 SASI_Mm01_00240046 predicted 207
7 SASI_Mm01_00240047 predicted 309
8 SASI_Mm01_00240048 predicted 260
9 SASI_Mm01_00240049 predicted 284
10 SASI_Mm01_00240050 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030063
ACBD7 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-122s21c1
Sequence:CCGGAGGAACTCTACGGGCTCTACACTCGAGTGTAGAGCCCGTAGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-251s21c1
Sequence:CCGGATGCCATGTGTGCCTATATTTCTCGAGAAATATAGGCACACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-177s21c1
Sequence:CCGGCCCAGCAATGTTAGATCTAAACTCGAGTTTAGATCTAACATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-178s21c1
Sequence:CCGGCCAGCAATGTTAGATCTAAAGCTCGAGCTTTAGATCTAACATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-250s21c1
Sequence:CCGGGATGCCATGTGTGCCTATATTCTCGAGAATATAGGCACACATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-305s21c1
Sequence:CCGGTTTAGAAGGTGACGGAGAAATCTCGAGATTTCTCCGTCACCTTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-276s21c1
Sequence:CCGGAGCGAGAGAGCTGATTGAGAACTCGAGTTCTCAATCAGCTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030063.2-331s21c1
Sequence:CCGGCTCCTTTGGAAGCCTTCATATCTCGAGATATGAAGGCTTCCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030063
ACBD7 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-122s21c1
Sequence:CCGGAGGAACTCTACGGGCTCTACACTCGAGTGTAGAGCCCGTAGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-251s21c1
Sequence:CCGGATGCCATGTGTGCCTATATTTCTCGAGAAATATAGGCACACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-177s21c1
Sequence:CCGGCCCAGCAATGTTAGATCTAAACTCGAGTTTAGATCTAACATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-178s21c1
Sequence:CCGGCCAGCAATGTTAGATCTAAAGCTCGAGCTTTAGATCTAACATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-250s21c1
Sequence:CCGGGATGCCATGTGTGCCTATATTCTCGAGAATATAGGCACACATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-305s21c1
Sequence:CCGGTTTAGAAGGTGACGGAGAAATCTCGAGATTTCTCCGTCACCTTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-276s21c1
Sequence:CCGGAGCGAGAGAGCTGATTGAGAACTCGAGTTCTCAATCAGCTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030063.2-331s21c1
Sequence:CCGGCTCCTTTGGAAGCCTTCATATCTCGAGATATGAAGGCTTCCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030063
ACBD7 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-122s21c1
Sequence:CCGGAGGAACTCTACGGGCTCTACACTCGAGTGTAGAGCCCGTAGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-251s21c1
Sequence:CCGGATGCCATGTGTGCCTATATTTCTCGAGAAATATAGGCACACATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-177s21c1
Sequence:CCGGCCCAGCAATGTTAGATCTAAACTCGAGTTTAGATCTAACATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-178s21c1
Sequence:CCGGCCAGCAATGTTAGATCTAAAGCTCGAGCTTTAGATCTAACATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-250s21c1
Sequence:CCGGGATGCCATGTGTGCCTATATTCTCGAGAATATAGGCACACATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.1-305s21c1
Sequence:CCGGTTTAGAAGGTGACGGAGAAATCTCGAGATTTCTCCGTCACCTTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030063.2-276s21c1
Sequence:CCGGAGCGAGAGAGCTGATTGAGAACTCGAGTTCTCAATCAGCTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030063.2-331s21c1
Sequence:CCGGCTCCTTTGGAAGCCTTCATATCTCGAGATATGAAGGCTTCCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039844
ACBD7 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA binding domain containing 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-154s21c1
Sequence:CCGGGCAATAGTTGGAGACATTAATCTCGAGATTAATGTCTCCAACTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-257s21c1
Sequence:CCGGATGCGACGAGTGCCTATATTTCTCGAGAAATATAGGCACTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-180s21c1
Sequence:CCGGGTGTCCAGGAATGCTAGATTTCTCGAGAAATCTAGCATTCCTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-307s21c1
Sequence:CCGGGGAATTTAGAATACAGCATATCTCGAGATATGCTGTATTCTAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039844.2-358s21c1
Sequence:CCGGTGCTATCATGACCTAACATTTCTCGAGAAATGTTAGGTCATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039844
ACBD7 MISSION shRNA shRNA Plasmid DNA
acyl-CoA binding domain containing 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-154s21c1
Sequence:CCGGGCAATAGTTGGAGACATTAATCTCGAGATTAATGTCTCCAACTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-257s21c1
Sequence:CCGGATGCGACGAGTGCCTATATTTCTCGAGAAATATAGGCACTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-180s21c1
Sequence:CCGGGTGTCCAGGAATGCTAGATTTCTCGAGAAATCTAGCATTCCTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-307s21c1
Sequence:CCGGGGAATTTAGAATACAGCATATCTCGAGATATGCTGTATTCTAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039844.2-358s21c1
Sequence:CCGGTGCTATCATGACCTAACATTTCTCGAGAAATGTTAGGTCATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039844
ACBD7 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA binding domain containing 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-154s21c1
Sequence:CCGGGCAATAGTTGGAGACATTAATCTCGAGATTAATGTCTCCAACTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-257s21c1
Sequence:CCGGATGCGACGAGTGCCTATATTTCTCGAGAAATATAGGCACTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-180s21c1
Sequence:CCGGGTGTCCAGGAATGCTAGATTTCTCGAGAAATCTAGCATTCCTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039844.2-307s21c1
Sequence:CCGGGGAATTTAGAATACAGCATATCTCGAGATATGCTGTATTCTAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039844.2-358s21c1
Sequence:CCGGTGCTATCATGACCTAACATTTCTCGAGAAATGTTAGGTCATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks