EMAIL THIS PAGE TO A FRIEND

ACCS

1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)

99 Gene Product Result for
Synonyms: ACS PHACS
UniProtKB ID: Q96QU6, Q8WUL4, Q96LX5
Gene ID:
Mouse(329470) 1-aminocyclopropane-1-carboxylate synthase (non-functional)
Rat(311218) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Zebrafish(541510) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
chicken(423170) 1-aminocyclopropane-1-carboxylate synthase homolog
domestic cat(101083367) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
dog(611393) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
cow(505649) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
sheep(101110616) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
domestic guinea pig(100722697) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127219 Rosetta Predictions human pricing
NM_032592 Rosetta Predictions human pricing
XM_001074505 Rosetta Predictions rat pricing
XM_001078618 Rosetta Predictions rat pricing
XM_230305 Rosetta Predictions rat pricing
NM_183220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328857 predicted 1199
2 SASI_Hs02_00328858 predicted 383
3 SASI_Hs02_00328859 predicted 905
4 SASI_Hs02_00328860 predicted 945
5 SASI_Hs02_00328861 predicted 1209
6 SASI_Hs02_00328862 predicted 1135
7 SASI_Hs02_00328863 predicted 939
8 SASI_Hs02_00328864 predicted 1112
9 SASI_Hs02_00328865 predicted 392
10 SASI_Hs02_00328866 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360123 predicted 1496
2 SASI_Hs02_00360124 predicted 686
3 SASI_Hs02_00360125 predicted 1201
4 SASI_Hs02_00360126 predicted 1246
5 SASI_Hs02_00360127 predicted 1501
6 SASI_Hs02_00360128 predicted 1425
7 SASI_Hs02_00360129 predicted 1238
8 SASI_Hs02_00360130 predicted 1408
9 SASI_Hs02_00360131 predicted 686
10 SASI_Hs01_00200368 predicted 1301
11 SASI_Hs01_00200363 predicted 1126
12 SASI_Hs01_00200364 predicted 1572
13 SASI_Hs01_00200365 predicted 885
14 SASI_Hs01_00200366 predicted 1755
15 SASI_Hs01_00200367 predicted 1891
16 SASI_Hs01_00200369 predicted 979
17 SASI_Hs01_00200370 predicted 582
18 SASI_Hs01_00200371 predicted 1013
19 SASI_Hs01_00200372 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346508 predicted 412
2 SASI_Rn02_00346509 predicted 220
3 SASI_Rn02_00346510 predicted 338
4 SASI_Rn02_00346511 predicted 341
5 SASI_Rn02_00346512 predicted 443
6 SASI_Rn02_00346513 predicted 340
7 SASI_Rn02_00346514 predicted 337
8 SASI_Rn02_00346515 predicted 528
9 SASI_Rn02_00346516 predicted 477
10 SASI_Rn02_00346517 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361477 predicted 940
2 SASI_Rn02_00361478 predicted 1726
3 SASI_Rn02_00361479 predicted 1149
4 SASI_Rn02_00361480 predicted 365
5 SASI_Rn02_00361481 predicted 1142
6 SASI_Rn02_00361482 predicted 427
7 SASI_Rn02_00361483 predicted 648
8 SASI_Rn02_00361484 predicted 1236
9 SASI_Rn02_00361485 predicted 888
10 SASI_Rn02_00361486 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148826 predicted 541
2 SASI_Rn01_00148827 predicted 1184
3 SASI_Rn01_00148828 predicted 526
4 SASI_Rn01_00148829 predicted 3677
5 SASI_Rn01_00148830 predicted 1092
6 SASI_Rn01_00148831 predicted 740
7 SASI_Rn01_00148832 predicted 593
8 SASI_Rn01_00148833 predicted 761
9 SASI_Rn01_00148834 predicted 788
10 SASI_Rn01_00148835 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178169 predicted 946
2 SASI_Mm02_00350317 predicted 1492
3 SASI_Mm01_00178170 predicted 1056
4 SASI_Mm01_00178172 predicted 526
5 SASI_Mm02_00350318 predicted 1479
6 SASI_Mm01_00178173 predicted 860
7 SASI_Mm01_00178174 predicted 341
8 SASI_Mm01_00178176 predicted 1540
9 SASI_Mm01_00178177 predicted 805
10 SASI_Mm01_00178178 predicted 618
11 SASI_Mm01_00178171 predicted 1500
12 SASI_Mm01_00178175 predicted 1490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032592
VALIDATED
ACCS MISSION shRNA Bacterial Glycerol Stock
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-688s21c1
Sequence:CCGGCCTACCACATGGATGAGTATGCTCGAGCATACTCATCCATGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1864s21c1
Sequence:CCGGAGCAGGTGCTTGCAGGCAAATCTCGAGATTTGCCTGCAAGCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-925s21c1
Sequence:CCGGAGAATGTGGTTGTCCTGAATGCTCGAGCATTCAGGACAACCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1774s21c1
Sequence:CCGGGCAAGGCCTTCGAGTGTAAAGCTCGAGCTTTACACTCGAAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-998s1c1
Sequence:CCGGCGTGTGTCTCTATGGCAACATCTCGAGATGTTGCCATAGAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032592.1-1200s1c1
Sequence:CCGGCTACAGGAGTACCTGGTATTTCTCGAGAAATACCAGGTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-581s1c1
Sequence:CCGGCCTGTCCTCTAGAGGAAGAATCTCGAGATTCTTCCTCTAGAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1257s1c1
Sequence:CCGGGTCTACATGCTGTCCGTGTTTCTCGAGAAACACGGACAGCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1631s1c1
Sequence:CCGGCTGGGTTGACTTGAGAAAGTACTCGAGTACTTTCTCAAGTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032592
VALIDATED
ACCS MISSION shRNA shRNA Plasmid DNA
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-688s21c1
Sequence:CCGGCCTACCACATGGATGAGTATGCTCGAGCATACTCATCCATGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1864s21c1
Sequence:CCGGAGCAGGTGCTTGCAGGCAAATCTCGAGATTTGCCTGCAAGCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-925s21c1
Sequence:CCGGAGAATGTGGTTGTCCTGAATGCTCGAGCATTCAGGACAACCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1774s21c1
Sequence:CCGGGCAAGGCCTTCGAGTGTAAAGCTCGAGCTTTACACTCGAAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-998s1c1
Sequence:CCGGCGTGTGTCTCTATGGCAACATCTCGAGATGTTGCCATAGAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032592.1-1200s1c1
Sequence:CCGGCTACAGGAGTACCTGGTATTTCTCGAGAAATACCAGGTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-581s1c1
Sequence:CCGGCCTGTCCTCTAGAGGAAGAATCTCGAGATTCTTCCTCTAGAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1257s1c1
Sequence:CCGGGTCTACATGCTGTCCGTGTTTCTCGAGAAACACGGACAGCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1631s1c1
Sequence:CCGGCTGGGTTGACTTGAGAAAGTACTCGAGTACTTTCTCAAGTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032592
VALIDATED
ACCS MISSION shRNA Lentiviral Transduction Particles
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-688s21c1
Sequence:CCGGCCTACCACATGGATGAGTATGCTCGAGCATACTCATCCATGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1864s21c1
Sequence:CCGGAGCAGGTGCTTGCAGGCAAATCTCGAGATTTGCCTGCAAGCACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-925s21c1
Sequence:CCGGAGAATGTGGTTGTCCTGAATGCTCGAGCATTCAGGACAACCACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032592.3-1774s21c1
Sequence:CCGGGCAAGGCCTTCGAGTGTAAAGCTCGAGCTTTACACTCGAAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-998s1c1
Sequence:CCGGCGTGTGTCTCTATGGCAACATCTCGAGATGTTGCCATAGAGACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032592.1-1200s1c1
Sequence:CCGGCTACAGGAGTACCTGGTATTTCTCGAGAAATACCAGGTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-581s1c1
Sequence:CCGGCCTGTCCTCTAGAGGAAGAATCTCGAGATTCTTCCTCTAGAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1257s1c1
Sequence:CCGGGTCTACATGCTGTCCGTGTTTCTCGAGAAACACGGACAGCATGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032592.1-1631s1c1
Sequence:CCGGCTGGGTTGACTTGAGAAAGTACTCGAGTACTTTCTCAAGTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183220
ACCS MISSION shRNA Bacterial Glycerol Stock
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183220.1-1818s1c1
Sequence:CCGGGCTTTGACCTTGAAGGACTTTCTCGAGAAAGTCCTTCAAGGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-307s1c1
Sequence:CCGGGCAAGGAGAATGCCTCAGAAACTCGAGTTTCTGAGGCATTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-814s1c1
Sequence:CCGGGCACATCTATCTCTATGGCAACTCGAGTTGCCATAGAGATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1019s1c1
Sequence:CCGGCTGCAGGACTTTCTGAGATTTCTCGAGAAATCTCAGAAAGTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1459s1c1
Sequence:CCGGCTTGAGAAAGTATCTGTGCAACTCGAGTTGCACAGATACTTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183220
ACCS MISSION shRNA shRNA Plasmid DNA
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183220.1-1818s1c1
Sequence:CCGGGCTTTGACCTTGAAGGACTTTCTCGAGAAAGTCCTTCAAGGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-307s1c1
Sequence:CCGGGCAAGGAGAATGCCTCAGAAACTCGAGTTTCTGAGGCATTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-814s1c1
Sequence:CCGGGCACATCTATCTCTATGGCAACTCGAGTTGCCATAGAGATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1019s1c1
Sequence:CCGGCTGCAGGACTTTCTGAGATTTCTCGAGAAATCTCAGAAAGTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1459s1c1
Sequence:CCGGCTTGAGAAAGTATCTGTGCAACTCGAGTTGCACAGATACTTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183220
ACCS MISSION shRNA Lentiviral Transduction Particles
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183220.1-1818s1c1
Sequence:CCGGGCTTTGACCTTGAAGGACTTTCTCGAGAAAGTCCTTCAAGGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-307s1c1
Sequence:CCGGGCAAGGAGAATGCCTCAGAAACTCGAGTTTCTGAGGCATTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-814s1c1
Sequence:CCGGGCACATCTATCTCTATGGCAACTCGAGTTGCCATAGAGATAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1019s1c1
Sequence:CCGGCTGCAGGACTTTCTGAGATTTCTCGAGAAATCTCAGAAAGTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183220.1-1459s1c1
Sequence:CCGGCTTGAGAAAGTATCTGTGCAACTCGAGTTGCACAGATACTTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks