EMAIL THIS PAGE TO A FRIEND

ACCSL

1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like

49 Gene Product Result for
UniProtKB ID: Q4AC99
Gene ID:
Mouse(381411) 1-aminocyclopropane-1-carboxylate synthase (non-functional)-like
Rat(690470) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
domestic guinea pig(100722418) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
naked mole-rat(101699003) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
sheep(101116173) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Domestic Rabbit(100346860) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
domestic cat(101083110) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
cow(522802) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Horse(100055792) 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU165141 MISSION® esiRNA esiRNA targeting mouse Accsl mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031854 Rosetta Predictions human pricing
NM_001109594 Rosetta Predictions rat pricing
NM_001033452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307856 predicted 1377
2 SASI_Hs01_00076523 predicted 269
3 SASI_Hs01_00076524 predicted 283
4 SASI_Hs01_00076525 predicted 1095
5 SASI_Hs01_00076526 predicted 545
6 SASI_Hs01_00076527 predicted 1090
7 SASI_Hs01_00076528 predicted 1118
8 SASI_Hs01_00076530 predicted 1494
9 SASI_Hs01_00076531 predicted 1030
10 SASI_Hs02_00307857 predicted 1584
11 SASI_Hs01_00076522 predicted 511
12 SASI_Hs01_00076529 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249914 predicted 341
2 SASI_Rn02_00249915 predicted 1164
3 SASI_Rn02_00249916 predicted 990
4 SASI_Rn02_00249917 predicted 902
5 SASI_Rn02_00249918 predicted 1374
6 SASI_Rn02_00249919 predicted 545
7 SASI_Rn02_00249920 predicted 400
8 SASI_Rn02_00249921 predicted 1655
9 SASI_Rn02_00249922 predicted 1487
10 SASI_Rn02_00249923 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084121 predicted 1578
2 SASI_Mm01_00084122 predicted 1003
3 SASI_Mm01_00084123 predicted 1502
4 SASI_Mm01_00084124 predicted 1269
5 SASI_Mm02_00288784 predicted 546
6 SASI_Mm02_00288785 predicted 610
7 SASI_Mm02_00288786 predicted 309
8 SASI_Mm02_00288787 predicted 667
9 SASI_Mm01_00084127 predicted 1646
10 SASI_Mm02_00288788 predicted 691
11 SASI_Mm01_00084125 predicted 1068
12 SASI_Mm01_00084126 predicted 292
13 SASI_Mm01_00084128 predicted 1225
14 SASI_Mm01_00084129 predicted 1217
15 SASI_Mm01_00084130 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031854
ACCSL MISSION shRNA Bacterial Glycerol Stock
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1577s1c1
Sequence:CCGGCCTGGACAACAAGCTATTGTTCTCGAGAACAATAGCTTGTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-931s1c1
Sequence:CCGGCTGTTACAAACACCCATCCTTCTCGAGAAGGATGGGTGTTTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1533s1c1
Sequence:CCGGGATCCCTGTACATTTGAAGAACTCGAGTTCTTCAAATGTACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1098s1c1
Sequence:CCGGGCCAAGAGGTATAACCTACATCTCGAGATGTAGGTTATACCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1590s1c1
Sequence:CCGGCTATTGTTATCCCGTGGCAAACTCGAGTTTGCCACGGGATAACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1376s1c1
Sequence:CCGGGAACACAGAATGGATTGACAACTCGAGTTGTCAATCCATTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1499s1c1
Sequence:CCGGCCTCTATGTCTGGATCAACTTCTCGAGAAGTTGATCCAGACATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031854.2-1068s21c1
Sequence:CCGGCCAGACTCACTGATGAAATACCTCGAGGTATTTCATCAGTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031854
ACCSL MISSION shRNA shRNA Plasmid DNA
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1577s1c1
Sequence:CCGGCCTGGACAACAAGCTATTGTTCTCGAGAACAATAGCTTGTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-931s1c1
Sequence:CCGGCTGTTACAAACACCCATCCTTCTCGAGAAGGATGGGTGTTTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1533s1c1
Sequence:CCGGGATCCCTGTACATTTGAAGAACTCGAGTTCTTCAAATGTACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1098s1c1
Sequence:CCGGGCCAAGAGGTATAACCTACATCTCGAGATGTAGGTTATACCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1590s1c1
Sequence:CCGGCTATTGTTATCCCGTGGCAAACTCGAGTTTGCCACGGGATAACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1376s1c1
Sequence:CCGGGAACACAGAATGGATTGACAACTCGAGTTGTCAATCCATTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1499s1c1
Sequence:CCGGCCTCTATGTCTGGATCAACTTCTCGAGAAGTTGATCCAGACATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031854.2-1068s21c1
Sequence:CCGGCCAGACTCACTGATGAAATACCTCGAGGTATTTCATCAGTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031854
ACCSL MISSION shRNA Lentiviral Transduction Particles
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1577s1c1
Sequence:CCGGCCTGGACAACAAGCTATTGTTCTCGAGAACAATAGCTTGTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-931s1c1
Sequence:CCGGCTGTTACAAACACCCATCCTTCTCGAGAAGGATGGGTGTTTGTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031854.1-1533s1c1
Sequence:CCGGGATCCCTGTACATTTGAAGAACTCGAGTTCTTCAAATGTACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1098s1c1
Sequence:CCGGGCCAAGAGGTATAACCTACATCTCGAGATGTAGGTTATACCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1590s1c1
Sequence:CCGGCTATTGTTATCCCGTGGCAAACTCGAGTTTGCCACGGGATAACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1376s1c1
Sequence:CCGGGAACACAGAATGGATTGACAACTCGAGTTGTCAATCCATTCTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031854.1-1499s1c1
Sequence:CCGGCCTCTATGTCTGGATCAACTTCTCGAGAAGTTGATCCAGACATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031854.2-1068s21c1
Sequence:CCGGCCAGACTCACTGATGAAATACCTCGAGGTATTTCATCAGTGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033452
ACCSL MISSION shRNA Bacterial Glycerol Stock
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1497s21c1
Sequence:CCGGCCAGAAGGCTTACAGCTATATCTCGAGATATAGCTGTAAGCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033452.3-1967s21c1
Sequence:CCGGTACGCTGAGTGTCTGACATTTCTCGAGAAATGTCAGACACTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1648s21c1
Sequence:CCGGCGGGACAAGAAGCTGTTATTACTCGAGTAATAACAGCTTCTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-551s21c1
Sequence:CCGGTCTATGAGTCTTACCACTTAACTCGAGTTAAGTGGTAAGACTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-358s21c1
Sequence:CCGGGTCAACTTCTTATGGTCTAACCTCGAGGTTAGACCATAAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033452
ACCSL MISSION shRNA shRNA Plasmid DNA
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1497s21c1
Sequence:CCGGCCAGAAGGCTTACAGCTATATCTCGAGATATAGCTGTAAGCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033452.3-1967s21c1
Sequence:CCGGTACGCTGAGTGTCTGACATTTCTCGAGAAATGTCAGACACTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1648s21c1
Sequence:CCGGCGGGACAAGAAGCTGTTATTACTCGAGTAATAACAGCTTCTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-551s21c1
Sequence:CCGGTCTATGAGTCTTACCACTTAACTCGAGTTAAGTGGTAAGACTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-358s21c1
Sequence:CCGGGTCAACTTCTTATGGTCTAACCTCGAGGTTAGACCATAAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033452
ACCSL MISSION shRNA Lentiviral Transduction Particles
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1497s21c1
Sequence:CCGGCCAGAAGGCTTACAGCTATATCTCGAGATATAGCTGTAAGCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033452.3-1967s21c1
Sequence:CCGGTACGCTGAGTGTCTGACATTTCTCGAGAAATGTCAGACACTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-1648s21c1
Sequence:CCGGCGGGACAAGAAGCTGTTATTACTCGAGTAATAACAGCTTCTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-551s21c1
Sequence:CCGGTCTATGAGTCTTACCACTTAACTCGAGTTAAGTGGTAAGACTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033452.3-358s21c1
Sequence:CCGGGTCAACTTCTTATGGTCTAACCTCGAGGTTAGACCATAAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks