EMAIL THIS PAGE TO A FRIEND

ACD

adrenocortical dysplasia homolog (mouse)

172 Gene Product Result for
Synonyms: PIP1 PTOP TINT1 TPP1
UniProtKB ID: Q96AP0, Q562H5, Q9H8F9
Gene ID:
Human(65057) Summary: This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
Mouse(497652) adrenocortical dysplasia
Rat(307798) adrenocortical dysplasia homolog (mouse)
Zebrafish(794664) adrenocortical dysplasia homolog
chicken(769451) adrenocortical dysplasia homolog (mouse)
cow(510353) adrenocortical dysplasia homolog (mouse)
domestic cat(101090066) adrenocortical dysplasia homolog (mouse)
dog(487931) adrenocortical dysplasia homolog (mouse)
sheep(101109037) adrenocortical dysplasia homolog (mouse)
naked mole-rat(101708975) adrenocortical dysplasia homolog (mouse)
domestic guinea pig(100730199) adrenocortical dysplasia homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407914 Anti-ACD antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100024 Anti-ACD antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2106190 Anti-ACD antibody produced in rabbit affinity isolated antibody horse, guinea pig, human
western blot pricing
HPA057660 Anti-ACD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1411281 Anti-ACD antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA049411 Anti-ACD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105243 Anti-ACD, (C-terminal) antibody produced in rabbit affinity isolated antibody horse, mouse, guinea pig
western blot pricing
WH0065057M2 Monoclonal Anti-ACD antibody produced in mouse clone 1D8-1B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405257 Monoclonal Anti-ACD antibody produced in mouse clone 1C11-1A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100523 Monoclonal Anti-ACD antibody produced in mouse clone ACD-A471, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178291 MISSION® esiRNA esiRNA targeting mouse Acd mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082486 Rosetta Predictions human pricing
NM_001082487 Rosetta Predictions human pricing
NM_022914 Rosetta Predictions human pricing
NM_001037193 Rosetta Predictions rat pricing
NM_001012638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316623 predicted 1289
2 SASI_Hs02_00316624 predicted 1437
3 SASI_Hs02_00316625 predicted 1426
4 SASI_Hs02_00316626 predicted 346
5 SASI_Hs02_00316627 predicted 1079
6 SASI_Hs02_00316628 predicted 1138
7 SASI_Hs02_00316629 predicted 352
8 SASI_Hs02_00316630 predicted 1165
9 SASI_Hs02_00316631 predicted 1142
10 SASI_Hs02_00316632 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316633 predicted 1278
2 SASI_Hs02_00316634 predicted 1433
3 SASI_Hs02_00316635 predicted 1418
4 SASI_Hs02_00316636 predicted 348
5 SASI_Hs02_00316637 predicted 1065
6 SASI_Hs02_00316638 predicted 349
7 SASI_Hs02_00316639 predicted 1153
8 SASI_Hs02_00316640 predicted 1134
9 SASI_Hs02_00316641 predicted 993
10 SASI_Hs02_00316642 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239402 predicted 1282
2 SASI_Hs02_00356234 predicted 1434
3 SASI_Hs01_00239404 predicted 1421
4 SASI_Hs01_00239406 predicted 350
5 SASI_Hs01_00239410 predicted 1069
6 SASI_Hs02_00356235 predicted 343
7 SASI_Hs02_00356236 predicted 1159
8 SASI_Hs02_00356237 predicted 1134
9 SASI_Hs02_00356238 predicted 996
10 SASI_Hs02_00356239 predicted 1354
11 SASI_Hs01_00239403 predicted 1697
12 SASI_Hs01_00239405 predicted 1801
13 SASI_Hs01_00239407 predicted 837
14 SASI_Hs01_00239408 predicted 758
15 SASI_Hs01_00239409 predicted 564
16 SASI_Hs01_00239411 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088132 predicted 880
2 SASI_Rn01_00088134 predicted 1011
3 SASI_Rn02_00204288 predicted 680
4 SASI_Rn01_00088136 predicted 732
5 SASI_Rn01_00088137 predicted 1032
6 SASI_Rn01_00088139 predicted 1016
7 SASI_Rn02_00204289 predicted 794
8 SASI_Rn02_00204290 predicted 732
9 SASI_Rn01_00088140 predicted 689
10 SASI_Rn01_00088141 predicted 814
11 SASI_Rn01_00088133 predicted 1154
12 SASI_Rn01_00088135 predicted 715
13 SASI_Rn01_00088138 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123702 predicted 464
2 SASI_Mm01_00123703 predicted 1188
3 SASI_Mm01_00123704 predicted 1176
4 SASI_Mm01_00123705 predicted 1112
5 SASI_Mm01_00123706 predicted 646
6 SASI_Mm01_00123707 predicted 482
7 SASI_Mm01_00123708 predicted 228
8 SASI_Mm01_00123710 predicted 647
9 SASI_Mm01_00123711 predicted 618
10 SASI_Mm02_00287125 predicted 779
11 SASI_Mm01_00123709 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022914
VALIDATED
ACD MISSION shRNA Bacterial Glycerol Stock
adrenocortical dysplasia homolog (mouse)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1090s1c1
Sequence:CCGGGTCCCAGCTTCTGGATGAAATCTCGAGATTTCATCCAGAAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1435s1c1
Sequence:CCGGCCACATGTCATCCGAGGAAAGCTCGAGCTTTCCTCGGATGACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1365s1c1
Sequence:CCGGACCTATCTCTGACCCTCATAGCTCGAGCTATGAGGGTCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1259s1c1
Sequence:CCGGGCTGTGCATCTCTGAGAATGACTCGAGTCATTCTCAGAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-1809s1c1
Sequence:CCGGGATGGTTCTGCCTTCCAGTATCTCGAGATACTGGAAGGCAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-993s1c1
Sequence:CCGGCGCAACCAAGACTTAGATGTTCTCGAGAACATCTAAGTCTTGGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-998s1c1
Sequence:CCGGCCAAGACTTAGATGTTCAGAACTCGAGTTCTGAACATCTAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-995s1c1
Sequence:CCGGCAACCAAGACTTAGATGTTCACTCGAGTGAACATCTAAGTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1694s1c1
Sequence:CCGGGTTCAAGGAGTTTGTAGGGTTCTCGAGAACCCTACAAACTCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1268s1c1
Sequence:CCGGCTCTGAGAATGACCAGCTAATCTCGAGATTAGCTGGTCATTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1689s1c1
Sequence:CCGGCTGGAGTTCAAGGAGTTTGTACTCGAGTACAAACTCCTTGAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022914
VALIDATED
ACD MISSION shRNA shRNA Plasmid DNA
adrenocortical dysplasia homolog (mouse)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1090s1c1
Sequence:CCGGGTCCCAGCTTCTGGATGAAATCTCGAGATTTCATCCAGAAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1435s1c1
Sequence:CCGGCCACATGTCATCCGAGGAAAGCTCGAGCTTTCCTCGGATGACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1365s1c1
Sequence:CCGGACCTATCTCTGACCCTCATAGCTCGAGCTATGAGGGTCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1259s1c1
Sequence:CCGGGCTGTGCATCTCTGAGAATGACTCGAGTCATTCTCAGAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-1809s1c1
Sequence:CCGGGATGGTTCTGCCTTCCAGTATCTCGAGATACTGGAAGGCAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-993s1c1
Sequence:CCGGCGCAACCAAGACTTAGATGTTCTCGAGAACATCTAAGTCTTGGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-998s1c1
Sequence:CCGGCCAAGACTTAGATGTTCAGAACTCGAGTTCTGAACATCTAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-995s1c1
Sequence:CCGGCAACCAAGACTTAGATGTTCACTCGAGTGAACATCTAAGTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1694s1c1
Sequence:CCGGGTTCAAGGAGTTTGTAGGGTTCTCGAGAACCCTACAAACTCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1268s1c1
Sequence:CCGGCTCTGAGAATGACCAGCTAATCTCGAGATTAGCTGGTCATTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1689s1c1
Sequence:CCGGCTGGAGTTCAAGGAGTTTGTACTCGAGTACAAACTCCTTGAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022914
VALIDATED
ACD MISSION shRNA Lentiviral Transduction Particles
adrenocortical dysplasia homolog (mouse)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1090s1c1
Sequence:CCGGGTCCCAGCTTCTGGATGAAATCTCGAGATTTCATCCAGAAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1435s1c1
Sequence:CCGGCCACATGTCATCCGAGGAAAGCTCGAGCTTTCCTCGGATGACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.2-1365s1c1
Sequence:CCGGACCTATCTCTGACCCTCATAGCTCGAGCTATGAGGGTCAGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1259s1c1
Sequence:CCGGGCTGTGCATCTCTGAGAATGACTCGAGTCATTCTCAGAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-1809s1c1
Sequence:CCGGGATGGTTCTGCCTTCCAGTATCTCGAGATACTGGAAGGCAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-993s1c1
Sequence:CCGGCGCAACCAAGACTTAGATGTTCTCGAGAACATCTAAGTCTTGGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-998s1c1
Sequence:CCGGCCAAGACTTAGATGTTCAGAACTCGAGTTCTGAACATCTAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022914.1-995s1c1
Sequence:CCGGCAACCAAGACTTAGATGTTCACTCGAGTGAACATCTAAGTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022914.1-1694s1c1
Sequence:CCGGGTTCAAGGAGTTTGTAGGGTTCTCGAGAACCCTACAAACTCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1268s1c1
Sequence:CCGGCTCTGAGAATGACCAGCTAATCTCGAGATTAGCTGGTCATTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022914.1-1689s1c1
Sequence:CCGGCTGGAGTTCAAGGAGTTTGTACTCGAGTACAAACTCCTTGAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012638
VALIDATED
ACD MISSION shRNA Bacterial Glycerol Stock
adrenocortical dysplasia homolog (mouse)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-467s1c1
Sequence:CCGGGATACAGGTGACTGGTTGCAACTCGAGTTGCAACCAGTCACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-1171s1c1
Sequence:CCGGCAGAGAGGCATCGTGATACTTCTCGAGAAGTATCACGATGCCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-485s1c1
Sequence:CCGGCAATCAGGATTCAGATGTGCACTCGAGTGCACATCTGAATCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012638.1-129s1c1
Sequence:CCGGCTAGGTTCAGAAACACTGTCACTCGAGTGACAGTGTTTCTGAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012638
VALIDATED
ACD MISSION shRNA shRNA Plasmid DNA
adrenocortical dysplasia homolog (mouse)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-467s1c1
Sequence:CCGGGATACAGGTGACTGGTTGCAACTCGAGTTGCAACCAGTCACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-1171s1c1
Sequence:CCGGCAGAGAGGCATCGTGATACTTCTCGAGAAGTATCACGATGCCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-485s1c1
Sequence:CCGGCAATCAGGATTCAGATGTGCACTCGAGTGCACATCTGAATCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012638.1-129s1c1
Sequence:CCGGCTAGGTTCAGAAACACTGTCACTCGAGTGACAGTGTTTCTGAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012638
VALIDATED
ACD MISSION shRNA Lentiviral Transduction Particles
adrenocortical dysplasia homolog (mouse)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-467s1c1
Sequence:CCGGGATACAGGTGACTGGTTGCAACTCGAGTTGCAACCAGTCACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-1171s1c1
Sequence:CCGGCAGAGAGGCATCGTGATACTTCTCGAGAAGTATCACGATGCCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001012638.1-485s1c1
Sequence:CCGGCAATCAGGATTCAGATGTGCACTCGAGTGCACATCTGAATCCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012638.1-129s1c1
Sequence:CCGGCTAGGTTCAGAAACACTGTCACTCGAGTGACAGTGTTTCTGAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks