EMAIL THIS PAGE TO A FRIEND

ACER1

alkaline ceramidase 1

Synonyms: ALKCDase1 ASAH3
UniProtKB ID: Q8TDN7
Gene ID:
Human(125981) Summary: Ceramides are synthesized during epidermal differentiation and accumulate within the interstices of the stratum corneum, where they represent critical components of the epidermal permeability barrier. Excess cellular ceramide can trigger antimitogenic signals and induce apoptosis, and the ceramide metabolites sphingosine and sphingosine-1-phosphate (S1P) are important bioregulatory molecules. Ceramide hydrolysis in the nucleated cell layers regulates keratinocyte proliferation and apoptosis in response to external stress. Ceramide hydrolysis also occurs at the stratum corneum, releasing free sphingoid base that functions as an endogenous antimicrobial agent. ACER1 is highly expressed in epidermis and catalyzes the hydrolysis of very long chain ceramides to generate sphingosine (Houben et al., 2006 [PubMed 16477081]
Mouse(171168) alkaline ceramidase 1
Rat(301118) alkaline ceramidase 1
Zebrafish(550266) alkaline ceramidase 1
chicken(420088) alkaline ceramidase 1
cow(518021) alkaline ceramidase 1
domestic cat(101095079) alkaline ceramidase 1
dog(611739) alkaline ceramidase 1
naked mole-rat(101702052) alkaline ceramidase 1
domestic guinea pig(100718251) alkaline ceramidase 1
sheep(101106585) alkaline ceramidase 1
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014011 MISSION® esiRNA esiRNA targeting mouse Asah3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133492 Rosetta Predictions human pricing
NM_001106875 Rosetta Predictions rat pricing
NM_175731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084729 predicted 498
2 SASI_Hs01_00084730 predicted 574
3 SASI_Hs01_00084731 predicted 348
4 SASI_Hs01_00084732 predicted 417
5 SASI_Hs01_00084733 predicted 548
6 SASI_Hs01_00084735 predicted 435
7 SASI_Hs01_00084736 predicted 546
8 SASI_Hs01_00084737 predicted 350
9 SASI_Hs01_00084738 predicted 476
10 SASI_Hs02_00363216 predicted 497
11 SASI_Hs01_00084734 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223266 predicted 409
2 SASI_Rn02_00223267 predicted 844
3 SASI_Rn02_00223268 predicted 458
4 SASI_Rn02_00223269 predicted 733
5 SASI_Rn02_00223270 predicted 664
6 SASI_Rn02_00223271 predicted 1037
7 SASI_Rn02_00223272 predicted 881
8 SASI_Rn02_00223273 predicted 659
9 SASI_Rn02_00223274 predicted 409
10 SASI_Rn02_00223275 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346642 predicted 415
2 SASI_Mm02_00346643 predicted 407
3 SASI_Mm02_00346644 predicted 725
4 SASI_Mm02_00346645 predicted 662
5 SASI_Mm02_00346646 predicted 907
6 SASI_Mm02_00346647 predicted 537
7 SASI_Mm02_00346648 predicted 456
8 SASI_Mm02_00346649 predicted 466
9 SASI_Mm02_00346650 predicted 574
10 SASI_Mm02_00346651 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133492
ACER1 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-592s1c1
Sequence:CCGGCAGAGGATTCATTTCTTCTATCTCGAGATAGAAGAAATGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-636s1c1
Sequence:CCGGCATCAGCATCACCTTCCCTTACTCGAGTAAGGGAAGGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-167s1c1
Sequence:CCGGCCCGCTACATTTACGTTGTCTCTCGAGAGACAACGTAAATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-81s1c1
Sequence:CCGGGTTCTACAACACGTTCTCCAACTCGAGTTGGAGAACGTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-123s1c1
Sequence:CCGGGCCACTGATGATGCTCCTGATCTCGAGATCAGGAGCATCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133492.2-914s21c1
Sequence:CCGGGCCTGTGTCTTGAGAAGATAGCTCGAGCTATCTTCTCAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-593s21c1
Sequence:CCGGTGATTGAGGTCTCCGTGGTTTCTCGAGAAACCACGGAGACCTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-557s21c1
Sequence:CCGGAGTACAGGAAGACCAGCAATACTCGAGTATTGCTGGTCTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133492
ACER1 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-592s1c1
Sequence:CCGGCAGAGGATTCATTTCTTCTATCTCGAGATAGAAGAAATGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-636s1c1
Sequence:CCGGCATCAGCATCACCTTCCCTTACTCGAGTAAGGGAAGGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-167s1c1
Sequence:CCGGCCCGCTACATTTACGTTGTCTCTCGAGAGACAACGTAAATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-81s1c1
Sequence:CCGGGTTCTACAACACGTTCTCCAACTCGAGTTGGAGAACGTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-123s1c1
Sequence:CCGGGCCACTGATGATGCTCCTGATCTCGAGATCAGGAGCATCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133492.2-914s21c1
Sequence:CCGGGCCTGTGTCTTGAGAAGATAGCTCGAGCTATCTTCTCAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-593s21c1
Sequence:CCGGTGATTGAGGTCTCCGTGGTTTCTCGAGAAACCACGGAGACCTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-557s21c1
Sequence:CCGGAGTACAGGAAGACCAGCAATACTCGAGTATTGCTGGTCTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133492
ACER1 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-592s1c1
Sequence:CCGGCAGAGGATTCATTTCTTCTATCTCGAGATAGAAGAAATGAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-636s1c1
Sequence:CCGGCATCAGCATCACCTTCCCTTACTCGAGTAAGGGAAGGTGATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-167s1c1
Sequence:CCGGCCCGCTACATTTACGTTGTCTCTCGAGAGACAACGTAAATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-81s1c1
Sequence:CCGGGTTCTACAACACGTTCTCCAACTCGAGTTGGAGAACGTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133492.1-123s1c1
Sequence:CCGGGCCACTGATGATGCTCCTGATCTCGAGATCAGGAGCATCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133492.2-914s21c1
Sequence:CCGGGCCTGTGTCTTGAGAAGATAGCTCGAGCTATCTTCTCAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-593s21c1
Sequence:CCGGTGATTGAGGTCTCCGTGGTTTCTCGAGAAACCACGGAGACCTCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133492.2-557s21c1
Sequence:CCGGAGTACAGGAAGACCAGCAATACTCGAGTATTGCTGGTCTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175731
ACER1 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175731.2-1799s1c1
Sequence:CCGGCCCTCCTTATATCCATCCATTCTCGAGAATGGATGGATATAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-676s1c1
Sequence:CCGGCGTCCTCATAAGCATCACATTCTCGAGAATGTGATGCTTATGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-412s1c1
Sequence:CCGGCCTGGTAACTATAACCACTATCTCGAGATAGTGGTTATAGTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-413s1c1
Sequence:CCGGCTGGTAACTATAACCACTATTCTCGAGAATAGTGGTTATAGTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-637s1c1
Sequence:CCGGGCAGCGGATTCACTTCTACTACTCGAGTAGTAGAAGTGAATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175731
ACER1 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175731.2-1799s1c1
Sequence:CCGGCCCTCCTTATATCCATCCATTCTCGAGAATGGATGGATATAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-676s1c1
Sequence:CCGGCGTCCTCATAAGCATCACATTCTCGAGAATGTGATGCTTATGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-412s1c1
Sequence:CCGGCCTGGTAACTATAACCACTATCTCGAGATAGTGGTTATAGTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-413s1c1
Sequence:CCGGCTGGTAACTATAACCACTATTCTCGAGAATAGTGGTTATAGTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-637s1c1
Sequence:CCGGGCAGCGGATTCACTTCTACTACTCGAGTAGTAGAAGTGAATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175731
ACER1 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175731.2-1799s1c1
Sequence:CCGGCCCTCCTTATATCCATCCATTCTCGAGAATGGATGGATATAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-676s1c1
Sequence:CCGGCGTCCTCATAAGCATCACATTCTCGAGAATGTGATGCTTATGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-412s1c1
Sequence:CCGGCCTGGTAACTATAACCACTATCTCGAGATAGTGGTTATAGTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-413s1c1
Sequence:CCGGCTGGTAACTATAACCACTATTCTCGAGAATAGTGGTTATAGTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175731.2-637s1c1
Sequence:CCGGGCAGCGGATTCACTTCTACTACTCGAGTAGTAGAAGTGAATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks