EMAIL THIS PAGE TO A FRIEND

ACER2

alkaline ceramidase 2

47 Gene Product Result for
Synonyms: ALKCDase2 ASAH3L
UniProtKB ID: Q5QJU3, A2A3R8, Q569G5, Q5VZR7, Q71RD2
Gene ID:
Human(340485) Summary: The sphingolipid metabolite sphingosine-1-phosphate promotes cell proliferation and survival, whereas its precursor, sphingosine, has the opposite effect. The ceramidase ACER2 hydrolyzes very long chain ceramides to generate sphingosine (Xu et al., 2006 [PubMed 16940153]
Mouse(230379) alkaline ceramidase 2
Rat(313339) alkaline ceramidase 2
sheep(101123535) alkaline ceramidase 2
domestic guinea pig(100726849) alkaline ceramidase 2
naked mole-rat(101723877) alkaline ceramidase 2
chicken(427235) alkaline ceramidase 2
dog(481553) alkaline ceramidase 2
cow(540732) alkaline ceramidase 2
domestic cat(101098748) alkaline ceramidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_294540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294540 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010887 Rosetta Predictions human pricing
NM_001107943 Rosetta Predictions rat pricing
NM_139306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305850 predicted 465
2 SASI_Hs01_00129446 predicted 235
3 SASI_Hs02_00305851 predicted 981
4 SASI_Hs01_00129447 predicted 641
5 SASI_Hs01_00129449 predicted 440
6 SASI_Hs01_00129450 predicted 885
7 SASI_Hs01_00129452 predicted 845
8 SASI_Hs01_00129453 predicted 672
9 SASI_Hs01_00129454 predicted 372
10 SASI_Hs01_00129455 predicted 407
11 SASI_Hs01_00129448 predicted 668
12 SASI_Hs01_00129451 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233815 predicted 262
2 SASI_Rn02_00233816 predicted 522
3 SASI_Rn02_00233817 predicted 997
4 SASI_Rn02_00233818 predicted 300
5 SASI_Rn02_00233819 predicted 318
6 SASI_Rn02_00233820 predicted 485
7 SASI_Rn02_00233821 predicted 1077
8 SASI_Rn02_00233822 predicted 502
9 SASI_Rn02_00233823 predicted 883
10 SASI_Rn02_00233824 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133863 predicted 950
2 SASI_Mm01_00133864 predicted 765
3 SASI_Mm02_00340009 predicted 758
4 SASI_Mm01_00133865 predicted 466
5 SASI_Mm01_00133866 predicted 672
6 SASI_Mm01_00133867 predicted 914
7 SASI_Mm01_00133868 predicted 824
8 SASI_Mm01_00133869 predicted 463
9 SASI_Mm01_00133870 predicted 372
10 SASI_Mm01_00133871 predicted 448
11 SASI_Mm01_00133872 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139306
VALIDATED
ACER2 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_139306.1-216s21c1
Sequence:CCGGACAGCGGCATCTACTTAATATCTCGAGATATTAAGTAGATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-663s21c1
Sequence:CCGGTGCACTGTGTGTGGCATATTCCTCGAGGAATATGCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-92s21c1
Sequence:CCGGTGCGAGGACAACTACACTATCCTCGAGGATAGTGTAGTTGTCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-439s21c1
Sequence:CCGGTACAACGTGCTTGGCGTTTATCTCGAGATAAACGCCAAGCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139306.1-2596s21c1
Sequence:CCGGCTCGGGAGCTGCCCTTATATACTCGAGTATATAAGGGCAGCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139306.1-2384s1c1
Sequence:CCGGGCGATTTACAAGGCAGGAATACTCGAGTATTCCTGCCTTGTAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-468s1c1
Sequence:CCGGCCATCAACAATATTTCCCTGACTCGAGTCAGGGAAATATTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-754s1c1
Sequence:CCGGGCAAGGTCCAGTCATCAGATTCTCGAGAATCTGATGACTGGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139306
VALIDATED
ACER2 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_139306.1-216s21c1
Sequence:CCGGACAGCGGCATCTACTTAATATCTCGAGATATTAAGTAGATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-663s21c1
Sequence:CCGGTGCACTGTGTGTGGCATATTCCTCGAGGAATATGCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-92s21c1
Sequence:CCGGTGCGAGGACAACTACACTATCCTCGAGGATAGTGTAGTTGTCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-439s21c1
Sequence:CCGGTACAACGTGCTTGGCGTTTATCTCGAGATAAACGCCAAGCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139306.1-2596s21c1
Sequence:CCGGCTCGGGAGCTGCCCTTATATACTCGAGTATATAAGGGCAGCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139306.1-2384s1c1
Sequence:CCGGGCGATTTACAAGGCAGGAATACTCGAGTATTCCTGCCTTGTAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-468s1c1
Sequence:CCGGCCATCAACAATATTTCCCTGACTCGAGTCAGGGAAATATTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-754s1c1
Sequence:CCGGGCAAGGTCCAGTCATCAGATTCTCGAGAATCTGATGACTGGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139306
VALIDATED
ACER2 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_139306.1-216s21c1
Sequence:CCGGACAGCGGCATCTACTTAATATCTCGAGATATTAAGTAGATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-663s21c1
Sequence:CCGGTGCACTGTGTGTGGCATATTCCTCGAGGAATATGCCACACACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-92s21c1
Sequence:CCGGTGCGAGGACAACTACACTATCCTCGAGGATAGTGTAGTTGTCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139306.1-439s21c1
Sequence:CCGGTACAACGTGCTTGGCGTTTATCTCGAGATAAACGCCAAGCACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139306.1-2596s21c1
Sequence:CCGGCTCGGGAGCTGCCCTTATATACTCGAGTATATAAGGGCAGCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139306.1-2384s1c1
Sequence:CCGGGCGATTTACAAGGCAGGAATACTCGAGTATTCCTGCCTTGTAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-468s1c1
Sequence:CCGGCCATCAACAATATTTCCCTGACTCGAGTCAGGGAAATATTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139306.1-754s1c1
Sequence:CCGGGCAAGGTCCAGTCATCAGATTCTCGAGAATCTGATGACTGGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294540
ACER2 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000050684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-310s1c1
Sequence:CCGGGCTTGTTTCGTCAGTATGCAACTCGAGTTGCATACTGACGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-758s1c1
Sequence:CCGGGCTGCTGTCATCCTTCAACTTCTCGAGAAGTTGAAGGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-956s1c1
Sequence:CCGGCAACAAGAAATCATCAGTCAACTCGAGTTGACTGATGATTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-653s1c1
Sequence:CCGGGCTAAAGAGGTGTGACAACATCTCGAGATGTTGTCACACCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294540
ACER2 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000050684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-310s1c1
Sequence:CCGGGCTTGTTTCGTCAGTATGCAACTCGAGTTGCATACTGACGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-758s1c1
Sequence:CCGGGCTGCTGTCATCCTTCAACTTCTCGAGAAGTTGAAGGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-956s1c1
Sequence:CCGGCAACAAGAAATCATCAGTCAACTCGAGTTGACTGATGATTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-653s1c1
Sequence:CCGGGCTAAAGAGGTGTGACAACATCTCGAGATGTTGTCACACCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294540
ACER2 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000050684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-310s1c1
Sequence:CCGGGCTTGTTTCGTCAGTATGCAACTCGAGTTGCATACTGACGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-758s1c1
Sequence:CCGGGCTGCTGTCATCCTTCAACTTCTCGAGAAGTTGAAGGATGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-956s1c1
Sequence:CCGGCAACAAGAAATCATCAGTCAACTCGAGTTGACTGATGATTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294540.3-653s1c1
Sequence:CCGGGCTAAAGAGGTGTGACAACATCTCGAGATGTTGTCACACCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks