EMAIL THIS PAGE TO A FRIEND

ACER3

alkaline ceramidase 3

195 Gene Product Result for
Synonyms: APHC PHCA
UniProtKB ID: Q9NUN7, B2RC99
Gene ID:
Mouse(66190) alkaline ceramidase 3
Rat(499210) alkaline ceramidase 3
chicken(419087) alkaline ceramidase 3
dog(607939) alkaline ceramidase 3
cow(615110) alkaline ceramidase 3
domestic cat(101088610) alkaline ceramidase 3
naked mole-rat(101714598) alkaline ceramidase 3
domestic guinea pig(100715506) alkaline ceramidase 3
sheep(101112511) alkaline ceramidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303797 ANTI-ACER3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, western blot pricing
SAB4502315 Anti-PHCA antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300757 Anti-PHCA antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018367 Rosetta Predictions human pricing
XM_001065019 Rosetta Predictions rat pricing
XM_574497 Rosetta Predictions rat pricing
NM_025408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222243 predicted 968
2 SASI_Hs01_00222244 predicted 616
3 SASI_Hs01_00222245 predicted 744
4 SASI_Hs01_00222246 predicted 470
5 SASI_Hs02_00351837 predicted 966
6 SASI_Hs01_00222248 predicted 381
7 SASI_Hs01_00222249 predicted 444
8 SASI_Hs01_00222250 predicted 720
9 SASI_Hs01_00222251 predicted 711
10 SASI_Hs02_00351838 predicted 527
11 SASI_Hs01_00222247 predicted 369
12 SASI_Hs01_00222252 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312571 predicted 933
2 SASI_Rn02_00312572 predicted 1088
3 SASI_Rn02_00312573 predicted 1171
4 SASI_Rn02_00312574 predicted 515
5 SASI_Rn02_00312575 predicted 588
6 SASI_Rn02_00312576 predicted 727
7 SASI_Rn02_00312577 predicted 854
8 SASI_Rn02_00312578 predicted 802
9 SASI_Rn02_00312579 predicted 865
10 SASI_Rn02_00312580 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402091 predicted 929
2 SASI_Rn02_00402092 predicted 1087
3 SASI_Rn02_00402093 predicted 1162
4 SASI_Rn02_00402094 predicted 522
5 SASI_Rn02_00402095 predicted 596
6 SASI_Rn02_00402096 predicted 726
7 SASI_Rn02_00402097 predicted 851
8 SASI_Rn02_00402098 predicted 803
9 SASI_Rn02_00402099 predicted 871
10 SASI_Rn02_00402100 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328159 predicted 541
2 SASI_Mm01_00041074 predicted 582
3 SASI_Mm01_00041075 predicted 384
4 SASI_Mm01_00041076 predicted 237
5 SASI_Mm01_00041077 predicted 443
6 SASI_Mm01_00041078 predicted 840
7 SASI_Mm01_00041079 predicted 914
8 SASI_Mm01_00041080 predicted 523
9 SASI_Mm01_00041081 predicted 870
10 SASI_Mm01_00041083 predicted 950
11 SASI_Mm01_00041082 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025408
VALIDATED
ACER3 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-1058s1c1
Sequence:CCGGGCTCCTGGCTTTATCTCGTTTCTCGAGAAACGAGATAAAGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-758s1c1
Sequence:CCGGGTTCTTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-510s1c1
Sequence:CCGGCCATCAGGTCATGTATGGAATCTCGAGATTCCATACATGACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-258s1c1
Sequence:CCGGGAAGCGGTACATTGCTGCTTACTCGAGTAAGCAGCAATGTACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025408.1-261s1c1
Sequence:CCGGGCGGTACATTGCTGCTTACTTCTCGAGAAGTAAGCAGCAATGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025408
VALIDATED
ACER3 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-1058s1c1
Sequence:CCGGGCTCCTGGCTTTATCTCGTTTCTCGAGAAACGAGATAAAGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-758s1c1
Sequence:CCGGGTTCTTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-510s1c1
Sequence:CCGGCCATCAGGTCATGTATGGAATCTCGAGATTCCATACATGACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-258s1c1
Sequence:CCGGGAAGCGGTACATTGCTGCTTACTCGAGTAAGCAGCAATGTACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025408.1-261s1c1
Sequence:CCGGGCGGTACATTGCTGCTTACTTCTCGAGAAGTAAGCAGCAATGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025408
VALIDATED
ACER3 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-1058s1c1
Sequence:CCGGGCTCCTGGCTTTATCTCGTTTCTCGAGAAACGAGATAAAGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-758s1c1
Sequence:CCGGGTTCTTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-510s1c1
Sequence:CCGGCCATCAGGTCATGTATGGAATCTCGAGATTCCATACATGACCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025408.1-258s1c1
Sequence:CCGGGAAGCGGTACATTGCTGCTTACTCGAGTAAGCAGCAATGTACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025408.1-261s1c1
Sequence:CCGGGCGGTACATTGCTGCTTACTTCTCGAGAAGTAAGCAGCAATGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018367
VALIDATED
ACER3 MISSION shRNA Bacterial Glycerol Stock
alkaline ceramidase 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018367.3-2953s1c1
Sequence:CCGGGCCAATTCTTTGAAGACCTTTCTCGAGAAAGGTCTTCAAAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-205s1c1
Sequence:CCGGCCTCCAATGTTCGGTGCAATTCTCGAGAATTGCACCGAACATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018367.3-696s1c1
Sequence:CCGGCATAGGTATTACCACACAATTCTCGAGAATTGTGTGGTAATACCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-253s1c1
Sequence:CCGGCGGTACATTGCTTCTTATTTACTCGAGTAAATAAGAAGCAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-749s1c1
Sequence:CCGGGTTCCTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-394s21c1
Sequence:CCGGTATACAGCTGTTGCATATTTGCTCGAGCAAATATGCAACAGCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1087s21c1
Sequence:CCGGGCTCATGGCTTTATCTTATTTCTCGAGAAATAAGATAAAGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-497s21c1
Sequence:CCGGAGTAACCACAGTTTACCTTAACTCGAGTTAAGGTAAACTGTGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-944s21c1
Sequence:CCGGCCATAGACCTGGCAGAATAAACTCGAGTTTATTCTGCCAGGTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-568s21c1
Sequence:CCGGCATTAGTACTTCGATCTATTTCTCGAGAAATAGATCGAAGTACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1207s21c1
Sequence:CCGGACAGTTTGTGCTGGTTATAAGCTCGAGCTTATAACCAGCACAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-219s21c1
Sequence:CCGGAGTAACCTGATCATGATTATACTCGAGTATAATCATGATCAGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018367
VALIDATED
ACER3 MISSION shRNA shRNA Plasmid DNA
alkaline ceramidase 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018367.3-2953s1c1
Sequence:CCGGGCCAATTCTTTGAAGACCTTTCTCGAGAAAGGTCTTCAAAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-205s1c1
Sequence:CCGGCCTCCAATGTTCGGTGCAATTCTCGAGAATTGCACCGAACATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018367.3-696s1c1
Sequence:CCGGCATAGGTATTACCACACAATTCTCGAGAATTGTGTGGTAATACCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-253s1c1
Sequence:CCGGCGGTACATTGCTTCTTATTTACTCGAGTAAATAAGAAGCAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-749s1c1
Sequence:CCGGGTTCCTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-394s21c1
Sequence:CCGGTATACAGCTGTTGCATATTTGCTCGAGCAAATATGCAACAGCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1087s21c1
Sequence:CCGGGCTCATGGCTTTATCTTATTTCTCGAGAAATAAGATAAAGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-497s21c1
Sequence:CCGGAGTAACCACAGTTTACCTTAACTCGAGTTAAGGTAAACTGTGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-944s21c1
Sequence:CCGGCCATAGACCTGGCAGAATAAACTCGAGTTTATTCTGCCAGGTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-568s21c1
Sequence:CCGGCATTAGTACTTCGATCTATTTCTCGAGAAATAGATCGAAGTACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1207s21c1
Sequence:CCGGACAGTTTGTGCTGGTTATAAGCTCGAGCTTATAACCAGCACAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-219s21c1
Sequence:CCGGAGTAACCTGATCATGATTATACTCGAGTATAATCATGATCAGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018367
VALIDATED
ACER3 MISSION shRNA Lentiviral Transduction Particles
alkaline ceramidase 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018367.3-2953s1c1
Sequence:CCGGGCCAATTCTTTGAAGACCTTTCTCGAGAAAGGTCTTCAAAGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-205s1c1
Sequence:CCGGCCTCCAATGTTCGGTGCAATTCTCGAGAATTGCACCGAACATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018367.3-696s1c1
Sequence:CCGGCATAGGTATTACCACACAATTCTCGAGAATTGTGTGGTAATACCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-253s1c1
Sequence:CCGGCGGTACATTGCTTCTTATTTACTCGAGTAAATAAGAAGCAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018367.3-749s1c1
Sequence:CCGGGTTCCTATCTTCACATCCTTTCTCGAGAAAGGATGTGAAGATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-394s21c1
Sequence:CCGGTATACAGCTGTTGCATATTTGCTCGAGCAAATATGCAACAGCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1087s21c1
Sequence:CCGGGCTCATGGCTTTATCTTATTTCTCGAGAAATAAGATAAAGCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-497s21c1
Sequence:CCGGAGTAACCACAGTTTACCTTAACTCGAGTTAAGGTAAACTGTGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-944s21c1
Sequence:CCGGCCATAGACCTGGCAGAATAAACTCGAGTTTATTCTGCCAGGTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-568s21c1
Sequence:CCGGCATTAGTACTTCGATCTATTTCTCGAGAAATAGATCGAAGTACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018367.5-1207s21c1
Sequence:CCGGACAGTTTGTGCTGGTTATAAGCTCGAGCTTATAACCAGCACAAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018367.5-219s21c1
Sequence:CCGGAGTAACCTGATCATGATTATACTCGAGTATAATCATGATCAGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks