EMAIL THIS PAGE TO A FRIEND

ACIN1

apoptotic chromatin condensation inducer 1

151 Gene Product Result for
Synonyms: ACINUS ACN fSAP152
Gene ID:
Human(22985) Summary: Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(56215) apoptotic chromatin condensation inducer 1
Rat(305884) apoptotic chromatin condensation inducer 1
Horse(100055865) apoptotic chromatin condensation inducer 1
cow(534600) apoptotic chromatin condensation inducer 1
domestic cat(101092859) apoptotic chromatin condensation inducer 1
dog(480247) apoptotic chromatin condensation inducer 1
sheep(101122696) apoptotic chromatin condensation inducer 1
domestic guinea pig(100730104) apoptotic chromatin condensation inducer 1
naked mole-rat(101718648) apoptotic chromatin condensation inducer 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014977 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014977 Rosetta Predictions human pricing
XM_001054451 Rosetta Predictions rat pricing
XM_001065227 Rosetta Predictions rat pricing
XM_240178 Rosetta Predictions rat pricing
NM_001085472 Rosetta Predictions mouse pricing
NM_001085473 Rosetta Predictions mouse pricing
NM_019567 Rosetta Predictions mouse pricing
NM_023190 Rosetta Predictions mouse pricing
NR_024029 Rosetta Predictions mouse pricing
NR_024030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135664 predicted 2024
2 SASI_Hs01_00135665 predicted 3232
3 SASI_Hs01_00135666 predicted 688
4 SASI_Hs01_00135667 predicted 2896
5 SASI_Hs01_00135668 predicted 2110
6 SASI_Hs01_00135669 predicted 1447
7 SASI_Hs02_00346694 predicted 2578
8 SASI_Hs01_00135670 predicted 2348
9 SASI_Hs01_00135672 predicted 705
10 SASI_Hs01_00135673 predicted 3226
11 SASI_Hs01_00135671 predicted 2639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275855 predicted 2764
2 SASI_Rn02_00275856 predicted 1902
3 SASI_Rn02_00275857 predicted 635
4 SASI_Rn02_00275858 predicted 3133
5 SASI_Rn02_00275859 predicted 1892
6 SASI_Rn02_00275860 predicted 1538
7 SASI_Rn02_00275861 predicted 3103
8 SASI_Rn02_00275862 predicted 2575
9 SASI_Rn02_00275863 predicted 617
10 SASI_Rn02_00275864 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313318 predicted 3687
2 SASI_Rn02_00313319 predicted 2635
3 SASI_Rn02_00313320 predicted 1789
4 SASI_Rn02_00313321 predicted 633
5 SASI_Rn02_00313322 predicted 2976
6 SASI_Rn02_00313323 predicted 1768
7 SASI_Rn02_00313324 predicted 1420
8 SASI_Rn02_00313325 predicted 2949
9 SASI_Rn02_00313326 predicted 2449
10 SASI_Rn02_00313327 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391564 predicted 2755
2 SASI_Rn02_00391565 predicted 1905
3 SASI_Rn02_00391566 predicted 630
4 SASI_Rn02_00391567 predicted 3133
5 SASI_Rn02_00391568 predicted 1885
6 SASI_Rn02_00391569 predicted 1533
7 SASI_Rn02_00391570 predicted 3108
8 SASI_Rn02_00391571 predicted 2571
9 SASI_Rn02_00391572 predicted 614
10 SASI_Rn02_00391573 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300482 predicted 838
2 SASI_Mm02_00300483 predicted 2034
3 SASI_Mm02_00300484 predicted 721
4 SASI_Mm02_00300485 predicted 667
5 SASI_Mm02_00300486 predicted 895
6 SASI_Mm02_00300487 predicted 2035
7 SASI_Mm02_00300488 predicted 736
8 SASI_Mm02_00300489 predicted 2052
9 SASI_Mm02_00300490 predicted 712
10 SASI_Mm02_00300491 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300492 predicted 4244
2 SASI_Mm02_00300493 predicted 3231
3 SASI_Mm02_00300494 predicted 4344
4 SASI_Mm02_00300495 predicted 3225
5 SASI_Mm02_00300496 predicted 4357
6 SASI_Mm02_00300497 predicted 4232
7 SASI_Mm02_00300498 predicted 3054
8 SASI_Mm02_00300499 predicted 4378
9 SASI_Mm02_00300500 predicted 3031
10 SASI_Mm02_00300501 predicted 3159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324612 predicted 2046
2 SASI_Mm02_00324613 predicted 1033
3 SASI_Mm02_00324614 predicted 2145
4 SASI_Mm02_00324615 predicted 1027
5 SASI_Mm02_00324616 predicted 2157
6 SASI_Mm02_00324617 predicted 2035
7 SASI_Mm02_00324618 predicted 859
8 SASI_Mm02_00324619 predicted 2174
9 SASI_Mm02_00324620 predicted 834
10 SASI_Mm02_00324621 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326913 predicted 4278
2 SASI_Mm02_00326914 predicted 3269
3 SASI_Mm02_00326915 predicted 4373
4 SASI_Mm01_00096752 predicted 3256
5 SASI_Mm02_00326916 predicted 4388
6 SASI_Mm02_00326917 predicted 4270
7 SASI_Mm01_00096756 predicted 3089
8 SASI_Mm01_00096757 predicted 4413
9 SASI_Mm02_00326918 predicted 3072
10 SASI_Mm02_00326919 predicted 3196
11 SASI_Mm01_00096748 predicted 3116
12 SASI_Mm01_00096749 predicted 2886
13 SASI_Mm01_00096750 predicted 2737
14 SASI_Mm01_00096751 predicted 2852
15 SASI_Mm01_00096753 predicted 2808
16 SASI_Mm01_00096754 predicted 3112
17 SASI_Mm01_00096755 predicted 2728
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354468 predicted 285
2 SASI_Mm02_00354469 predicted 582
3 SASI_Mm02_00354470 predicted 438
4 SASI_Mm02_00354471 predicted 302
5 SASI_Mm02_00354472 predicted 964
6 SASI_Mm02_00354473 predicted 506
7 SASI_Mm02_00354474 predicted 2093
8 SASI_Mm02_00354475 predicted 287
9 SASI_Mm02_00354476 predicted 286
10 SASI_Mm02_00354477 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354478 predicted 1941
2 SASI_Mm02_00354479 predicted 290
3 SASI_Mm02_00354480 predicted 539
4 SASI_Mm02_00354481 predicted 455
5 SASI_Mm02_00354482 predicted 435
6 SASI_Mm02_00354483 predicted 467
7 SASI_Mm02_00354484 predicted 296
8 SASI_Mm02_00354485 predicted 927
9 SASI_Mm02_00354486 predicted 2058
10 SASI_Mm02_00354487 predicted 1930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019567
VALIDATED
ACIN1 MISSION shRNA Bacterial Glycerol Stock
apoptotic chromatin condensation inducer 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019567.1-2074s1c1
Sequence:CCGGCCCTCTCCTTTCTTCCTGTTACTCGAGTAACAGGAAGAAAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-534s1c1
Sequence:CCGGCCCAAATCTCTGAGGATGAGACTCGAGTCTCATCCTCAGAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-985s1c1
Sequence:CCGGCAAGATCAAATCTCATTGCTTCTCGAGAAGCAATGAGATTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-298s1c1
Sequence:CCGGGCCCAAGTCATTCAAGAGGAACTCGAGTTCCTCTTGAATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-1529s1c1
Sequence:CCGGCCTCTGACTGAGAGCCAAATTCTCGAGAATTTGGCTCTCAGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-1174s21c1
Sequence:CCGGGATCGGCCATCTGAAACTAAGCTCGAGCTTAGTTTCAGATGGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-572s21c1
Sequence:CCGGAGGATGAGACAGAGCGTAATGCTCGAGCATTACGCTCTGTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-2177s21c1
Sequence:CCGGACCAGTGTCCCACGCTCATTTCTCGAGAAATGAGCGTGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-948s21c1
Sequence:CCGGAGGCCAGCTGAAGGAATTATTCTCGAGAATAATTCCTTCAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019567.2-785s21c1
Sequence:CCGGTAACATTAGGAGATACCTTAACTCGAGTTAAGGTATCTCCTAATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019567
VALIDATED
ACIN1 MISSION shRNA shRNA Plasmid DNA
apoptotic chromatin condensation inducer 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019567.1-2074s1c1
Sequence:CCGGCCCTCTCCTTTCTTCCTGTTACTCGAGTAACAGGAAGAAAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-534s1c1
Sequence:CCGGCCCAAATCTCTGAGGATGAGACTCGAGTCTCATCCTCAGAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-985s1c1
Sequence:CCGGCAAGATCAAATCTCATTGCTTCTCGAGAAGCAATGAGATTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-298s1c1
Sequence:CCGGGCCCAAGTCATTCAAGAGGAACTCGAGTTCCTCTTGAATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-1529s1c1
Sequence:CCGGCCTCTGACTGAGAGCCAAATTCTCGAGAATTTGGCTCTCAGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-1174s21c1
Sequence:CCGGGATCGGCCATCTGAAACTAAGCTCGAGCTTAGTTTCAGATGGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-572s21c1
Sequence:CCGGAGGATGAGACAGAGCGTAATGCTCGAGCATTACGCTCTGTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-2177s21c1
Sequence:CCGGACCAGTGTCCCACGCTCATTTCTCGAGAAATGAGCGTGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-948s21c1
Sequence:CCGGAGGCCAGCTGAAGGAATTATTCTCGAGAATAATTCCTTCAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019567.2-785s21c1
Sequence:CCGGTAACATTAGGAGATACCTTAACTCGAGTTAAGGTATCTCCTAATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019567
VALIDATED
ACIN1 MISSION shRNA Lentiviral Transduction Particles
apoptotic chromatin condensation inducer 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019567.1-2074s1c1
Sequence:CCGGCCCTCTCCTTTCTTCCTGTTACTCGAGTAACAGGAAGAAAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-534s1c1
Sequence:CCGGCCCAAATCTCTGAGGATGAGACTCGAGTCTCATCCTCAGAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-985s1c1
Sequence:CCGGCAAGATCAAATCTCATTGCTTCTCGAGAAGCAATGAGATTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-298s1c1
Sequence:CCGGGCCCAAGTCATTCAAGAGGAACTCGAGTTCCTCTTGAATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019567.1-1529s1c1
Sequence:CCGGCCTCTGACTGAGAGCCAAATTCTCGAGAATTTGGCTCTCAGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-1174s21c1
Sequence:CCGGGATCGGCCATCTGAAACTAAGCTCGAGCTTAGTTTCAGATGGCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-572s21c1
Sequence:CCGGAGGATGAGACAGAGCGTAATGCTCGAGCATTACGCTCTGTCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-2177s21c1
Sequence:CCGGACCAGTGTCCCACGCTCATTTCTCGAGAAATGAGCGTGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019567.2-948s21c1
Sequence:CCGGAGGCCAGCTGAAGGAATTATTCTCGAGAATAATTCCTTCAGCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019567.2-785s21c1
Sequence:CCGGTAACATTAGGAGATACCTTAACTCGAGTTAAGGTATCTCCTAATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014977
VALIDATED
ACIN1 MISSION shRNA Bacterial Glycerol Stock
apoptotic chromatin condensation inducer 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014977.1-4555s1c1
Sequence:CCGGCCTCCCTCTCATTTCCCATTACTCGAGTAATGGGAAATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3391s1c1
Sequence:CCGGCCTTTCACTTTAGGCCAGCTACTCGAGTAGCTGGCCTAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3392s1c1
Sequence:CCGGCTTTCACTTTAGGCCAGCTAACTCGAGTTAGCTGGCCTAAAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-1219s1c1
Sequence:CCGGGCACCAATCCTGAAAGAGTTTCTCGAGAAACTCTTTCAGGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-2775s1c1
Sequence:CCGGGCCCAAATCATTCAAGAGGAACTCGAGTTCCTCTTGAATGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-3456s21c1
Sequence:CCGGTCTGGATTGACAAGATCAAATCTCGAGATTTGATCTTGTCAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-1108s21c1
Sequence:CCGGGGTCAGAGCAGATCGAAATTTCTCGAGAAATTTCGATCTGCTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-2923s21c1
Sequence:CCGGTATCACCACTGAATCACTAAACTCGAGTTTAGTGATTCAGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-1703s21c1
Sequence:CCGGGCTGACACCAGGGAGCTATTACTCGAGTAATAGCTCCCTGGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3802s21c1
Sequence:CCGGGACTCGATCAGAGCGTGAATGCTCGAGCATTCACGCTCTGATCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3591s21c1
Sequence:CCGGAGCAAGATGAGCTGGATTATCCTCGAGGATAATCCAGCTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-4468s21c1
Sequence:CCGGATCCCTACATACATACCAAATCTCGAGATTTGGTATGTATGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014977.3-4675s21c1
Sequence:CCGGTACCACCTCCCTGGGTACTTACTCGAGTAAGTACCCAGGGAGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014977
VALIDATED
ACIN1 MISSION shRNA shRNA Plasmid DNA
apoptotic chromatin condensation inducer 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014977.1-4555s1c1
Sequence:CCGGCCTCCCTCTCATTTCCCATTACTCGAGTAATGGGAAATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3391s1c1
Sequence:CCGGCCTTTCACTTTAGGCCAGCTACTCGAGTAGCTGGCCTAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3392s1c1
Sequence:CCGGCTTTCACTTTAGGCCAGCTAACTCGAGTTAGCTGGCCTAAAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-1219s1c1
Sequence:CCGGGCACCAATCCTGAAAGAGTTTCTCGAGAAACTCTTTCAGGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-2775s1c1
Sequence:CCGGGCCCAAATCATTCAAGAGGAACTCGAGTTCCTCTTGAATGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-3456s21c1
Sequence:CCGGTCTGGATTGACAAGATCAAATCTCGAGATTTGATCTTGTCAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-1108s21c1
Sequence:CCGGGGTCAGAGCAGATCGAAATTTCTCGAGAAATTTCGATCTGCTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-2923s21c1
Sequence:CCGGTATCACCACTGAATCACTAAACTCGAGTTTAGTGATTCAGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-1703s21c1
Sequence:CCGGGCTGACACCAGGGAGCTATTACTCGAGTAATAGCTCCCTGGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3802s21c1
Sequence:CCGGGACTCGATCAGAGCGTGAATGCTCGAGCATTCACGCTCTGATCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3591s21c1
Sequence:CCGGAGCAAGATGAGCTGGATTATCCTCGAGGATAATCCAGCTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-4468s21c1
Sequence:CCGGATCCCTACATACATACCAAATCTCGAGATTTGGTATGTATGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014977.3-4675s21c1
Sequence:CCGGTACCACCTCCCTGGGTACTTACTCGAGTAAGTACCCAGGGAGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014977
VALIDATED
ACIN1 MISSION shRNA Lentiviral Transduction Particles
apoptotic chromatin condensation inducer 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014977.1-4555s1c1
Sequence:CCGGCCTCCCTCTCATTTCCCATTACTCGAGTAATGGGAAATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3391s1c1
Sequence:CCGGCCTTTCACTTTAGGCCAGCTACTCGAGTAGCTGGCCTAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-3392s1c1
Sequence:CCGGCTTTCACTTTAGGCCAGCTAACTCGAGTTAGCTGGCCTAAAGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-1219s1c1
Sequence:CCGGGCACCAATCCTGAAAGAGTTTCTCGAGAAACTCTTTCAGGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014977.1-2775s1c1
Sequence:CCGGGCCCAAATCATTCAAGAGGAACTCGAGTTCCTCTTGAATGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-3456s21c1
Sequence:CCGGTCTGGATTGACAAGATCAAATCTCGAGATTTGATCTTGTCAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014977.3-1108s21c1
Sequence:CCGGGGTCAGAGCAGATCGAAATTTCTCGAGAAATTTCGATCTGCTCTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-2923s21c1
Sequence:CCGGTATCACCACTGAATCACTAAACTCGAGTTTAGTGATTCAGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-1703s21c1
Sequence:CCGGGCTGACACCAGGGAGCTATTACTCGAGTAATAGCTCCCTGGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3802s21c1
Sequence:CCGGGACTCGATCAGAGCGTGAATGCTCGAGCATTCACGCTCTGATCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-3591s21c1
Sequence:CCGGAGCAAGATGAGCTGGATTATCCTCGAGGATAATCCAGCTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014977.3-4468s21c1
Sequence:CCGGATCCCTACATACATACCAAATCTCGAGATTTGGTATGTATGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014977.3-4675s21c1
Sequence:CCGGTACCACCTCCCTGGGTACTTACTCGAGTAAGTACCCAGGGAGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks