EMAIL THIS PAGE TO A FRIEND

ACKR2

atypical chemokine receptor 2

63 Gene Product Result for
Synonyms: CCBP2 CCR10 CCR9 CMKBR9 D6 hD6
Gene ID:
Human(1238) Summary: This gene encodes a beta chemokine receptor, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptor-mediated signal transduction are critical for the recruitment of effector immune cells to the inflammation site. This gene is expressed in a range of tissues and hemopoietic cells. The expression of this receptor in lymphatic endothelial cells and overexpression in vascular tumors suggested its function in chemokine-driven recirculation of leukocytes and possible chemokine effects on the development and growth of vascular tumors. This receptor appears to bind the majority of beta-chemokine family members; however, its specific function remains unknown. This gene is mapped to chromosome 3p21.3, a region that includes a cluster of chemokine receptor genes. [provided by RefSeq, Jul 2008]
Mouse(59289) atypical chemokine receptor 2
Rat(140473) atypical chemokine receptor 2
cow(512583) atypical chemokine receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001296 Rosetta Predictions human pricing
NM_078621 Rosetta Predictions rat pricing
NM_021609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106876 predicted 532
2 SASI_Hs01_00106877 predicted 1017
3 SASI_Hs01_00106878 predicted 703
4 SASI_Hs02_00331555 predicted 720
5 SASI_Hs01_00106880 predicted 981
6 SASI_Hs01_00106882 predicted 512
7 SASI_Hs01_00106883 predicted 955
8 SASI_Hs01_00106884 predicted 503
9 SASI_Hs01_00106885 predicted 519
10 SASI_Hs02_00331556 predicted 749
11 SASI_Hs01_00106879 predicted 836
12 SASI_Hs01_00106881 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066752 predicted 1226
2 SASI_Rn02_00267198 predicted 1060
3 SASI_Rn01_00066754 predicted 345
4 SASI_Rn01_00066755 predicted 960
5 SASI_Rn02_00267199 predicted 723
6 SASI_Rn01_00066756 predicted 1399
7 SASI_Rn01_00066757 predicted 746
8 SASI_Rn01_00066758 predicted 1294
9 SASI_Rn01_00066759 predicted 1340
10 SASI_Rn02_00267200 predicted 534
11 SASI_Rn01_00066750 predicted 413
12 SASI_Rn01_00066751 predicted 831
13 SASI_Rn01_00066753 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155143 predicted 1141
2 SASI_Mm01_00155144 predicted 626
3 SASI_Mm01_00155145 predicted 1068
4 SASI_Mm01_00155146 predicted 939
5 SASI_Mm01_00155147 predicted 1692
6 SASI_Mm01_00155149 predicted 1654
7 SASI_Mm01_00155150 predicted 329
8 SASI_Mm01_00155151 predicted 1637
9 SASI_Mm01_00155152 predicted 1080
10 SASI_Mm02_00326379 predicted 1669
11 SASI_Mm01_00155148 predicted 1249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021609
ACKR2 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021609.3-1680s21c1
Sequence:CCGGTCAAGGGCCATGTGATCATTCCTCGAGGAATGATCACATGGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021609.3-509s21c1
Sequence:CCGGAGACGGACGATGGAGCTTTACCTCGAGGTAAAGCTCCATCGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-1071s1c1
Sequence:CCGGCCATATAACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-359s1c1
Sequence:CCGGCTTAGATGATATGACCATCTTCTCGAGAAGATGGTCATATCATCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021609.2-2415s1c1
Sequence:CCGGCCTGCTGAGAACACTAGGTATCTCGAGATACCTAGTGTTCTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-554s1c1
Sequence:CCGGCCTCTTGTTTGTAGTGACTATCTCGAGATAGTCACTACAAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-641s1c1
Sequence:CCGGCACTCTCTACTCTATTAACTTCTCGAGAAGTTAATAGAGTAGAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021609
ACKR2 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021609.3-1680s21c1
Sequence:CCGGTCAAGGGCCATGTGATCATTCCTCGAGGAATGATCACATGGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021609.3-509s21c1
Sequence:CCGGAGACGGACGATGGAGCTTTACCTCGAGGTAAAGCTCCATCGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-1071s1c1
Sequence:CCGGCCATATAACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-359s1c1
Sequence:CCGGCTTAGATGATATGACCATCTTCTCGAGAAGATGGTCATATCATCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021609.2-2415s1c1
Sequence:CCGGCCTGCTGAGAACACTAGGTATCTCGAGATACCTAGTGTTCTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-554s1c1
Sequence:CCGGCCTCTTGTTTGTAGTGACTATCTCGAGATAGTCACTACAAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-641s1c1
Sequence:CCGGCACTCTCTACTCTATTAACTTCTCGAGAAGTTAATAGAGTAGAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021609
ACKR2 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021609.3-1680s21c1
Sequence:CCGGTCAAGGGCCATGTGATCATTCCTCGAGGAATGATCACATGGCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021609.3-509s21c1
Sequence:CCGGAGACGGACGATGGAGCTTTACCTCGAGGTAAAGCTCCATCGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-1071s1c1
Sequence:CCGGCCATATAACCTCACCTTGTTTCTCGAGAAACAAGGTGAGGTTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-359s1c1
Sequence:CCGGCTTAGATGATATGACCATCTTCTCGAGAAGATGGTCATATCATCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021609.2-2415s1c1
Sequence:CCGGCCTGCTGAGAACACTAGGTATCTCGAGATACCTAGTGTTCTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-554s1c1
Sequence:CCGGCCTCTTGTTTGTAGTGACTATCTCGAGATAGTCACTACAAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021609.2-641s1c1
Sequence:CCGGCACTCTCTACTCTATTAACTTCTCGAGAAGTTAATAGAGTAGAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001296
ACKR2 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-755s21c1
Sequence:CCGGGTGGAACTGCCACGCAGATTTCTCGAGAAATCTGCGTGGCAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-504s21c1
Sequence:CCGGCATTGGGTCTTCGGGAGTTTCCTCGAGGAAACTCCCGAAGACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-412s21c1
Sequence:CCGGGGCGGATGGTTGAGATCTATCCTCGAGGATAGATCTCAACCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-539s21c1
Sequence:CCGGGAGCACTCTTTATACTATTAACTCGAGTTAATAGTATAAAGAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001296.3-1401s1c1
Sequence:CCGGCCTCAGTGACTGTGTTGCTAACTCGAGTTAGCAACACAGTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-432s1c1
Sequence:CCGGGCCATCTCCAACCTTCTGTTTCTCGAGAAACAGAAGGTTGGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-1271s1c1
Sequence:CCGGGCAGTCTGAGAACTACCCTAACTCGAGTTAGGGTAGTTCTCAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-960s1c1
Sequence:CCGGCCATACAATCTCACCTTGTTTCTCGAGAAACAAGGTGAGATTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-503s1c1
Sequence:CCGGCGGGAGTTTCTTGTGCAAGATCTCGAGATCTTGCACAAGAAACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001296
ACKR2 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-755s21c1
Sequence:CCGGGTGGAACTGCCACGCAGATTTCTCGAGAAATCTGCGTGGCAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-504s21c1
Sequence:CCGGCATTGGGTCTTCGGGAGTTTCCTCGAGGAAACTCCCGAAGACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-412s21c1
Sequence:CCGGGGCGGATGGTTGAGATCTATCCTCGAGGATAGATCTCAACCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-539s21c1
Sequence:CCGGGAGCACTCTTTATACTATTAACTCGAGTTAATAGTATAAAGAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001296.3-1401s1c1
Sequence:CCGGCCTCAGTGACTGTGTTGCTAACTCGAGTTAGCAACACAGTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-432s1c1
Sequence:CCGGGCCATCTCCAACCTTCTGTTTCTCGAGAAACAGAAGGTTGGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-1271s1c1
Sequence:CCGGGCAGTCTGAGAACTACCCTAACTCGAGTTAGGGTAGTTCTCAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-960s1c1
Sequence:CCGGCCATACAATCTCACCTTGTTTCTCGAGAAACAAGGTGAGATTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-503s1c1
Sequence:CCGGCGGGAGTTTCTTGTGCAAGATCTCGAGATCTTGCACAAGAAACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001296
ACKR2 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-755s21c1
Sequence:CCGGGTGGAACTGCCACGCAGATTTCTCGAGAAATCTGCGTGGCAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-504s21c1
Sequence:CCGGCATTGGGTCTTCGGGAGTTTCCTCGAGGAAACTCCCGAAGACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-412s21c1
Sequence:CCGGGGCGGATGGTTGAGATCTATCCTCGAGGATAGATCTCAACCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001296.4-539s21c1
Sequence:CCGGGAGCACTCTTTATACTATTAACTCGAGTTAATAGTATAAAGAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001296.3-1401s1c1
Sequence:CCGGCCTCAGTGACTGTGTTGCTAACTCGAGTTAGCAACACAGTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-432s1c1
Sequence:CCGGGCCATCTCCAACCTTCTGTTTCTCGAGAAACAGAAGGTTGGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-1271s1c1
Sequence:CCGGGCAGTCTGAGAACTACCCTAACTCGAGTTAGGGTAGTTCTCAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-960s1c1
Sequence:CCGGCCATACAATCTCACCTTGTTTCTCGAGAAACAAGGTGAGATTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001296.3-503s1c1
Sequence:CCGGCGGGAGTTTCTTGTGCAAGATCTCGAGATCTTGCACAAGAAACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks