EMAIL THIS PAGE TO A FRIEND

ACKR3

atypical chemokine receptor 3

66 Gene Product Result for
Synonyms: CMKOR1 CXC-R7 CXCR-7 CXCR7 GPR159 RDC-1 RDC1
Gene ID:
Human(57007) Summary: This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008]
Mouse(12778) atypical chemokine receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020311 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028171 MISSION® esiRNA esiRNA targeting mouse Cxcr7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020311 siRNAs that have been validated in the lab human pricing
NM_007722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020311 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062875 validated 750
2 SASI_Hs01_00062877 predicted 766
3 SASI_Hs01_00062878 predicted 890
4 SASI_Hs01_00062879 predicted 958
5 SASI_Hs01_00062880 predicted 1274
6 SASI_Hs02_00353225 predicted 957
7 SASI_Hs01_00062881 predicted 571
8 SASI_Hs01_00062882 predicted 1340
9 SASI_Hs01_00062883 predicted 1375
10 SASI_Hs02_00353226 predicted 1344
11 SASI_Hs01_00062876 predicted 577
12 SASI_Hs01_00062884 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028412 predicted 584
2 SASI_Mm01_00028413 predicted 648
3 SASI_Mm01_00028414 predicted 860
4 SASI_Mm01_00028415 predicted 660
5 SASI_Mm01_00028416 predicted 785
6 SASI_Mm01_00028417 predicted 223
7 SASI_Mm01_00028418 predicted 455
8 SASI_Mm01_00028419 predicted 595
9 SASI_Mm01_00028420 predicted 1066
10 SASI_Mm02_00312303 predicted 490
11 SASI_Mm01_00028421 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007722
VALIDATED
ACKR3 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-142s1c1
Sequence:CCGGGCCTGGCAACTACTCTGACATCTCGAGATGTCAGAGTAGTTGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-462s1c1
Sequence:CCGGGCAAGATCACACACCTCATTTCTCGAGAAATGAGGTGTGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007722.2-249s1c1
Sequence:CCGGCCCTCTCCTTCATCTACATTTCTCGAGAAATGTAGATGAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007722.2-2308s1c1
Sequence:CCGGCCCACTGTCTACTCAGGAAATCTCGAGATTTCCTGAGTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-784s1c1
Sequence:CCGGCTTCACTATCATTGCGATCTTCTCGAGAAGATCGCAATGATAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007722
VALIDATED
ACKR3 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-142s1c1
Sequence:CCGGGCCTGGCAACTACTCTGACATCTCGAGATGTCAGAGTAGTTGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-462s1c1
Sequence:CCGGGCAAGATCACACACCTCATTTCTCGAGAAATGAGGTGTGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007722.2-249s1c1
Sequence:CCGGCCCTCTCCTTCATCTACATTTCTCGAGAAATGTAGATGAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007722.2-2308s1c1
Sequence:CCGGCCCACTGTCTACTCAGGAAATCTCGAGATTTCCTGAGTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-784s1c1
Sequence:CCGGCTTCACTATCATTGCGATCTTCTCGAGAAGATCGCAATGATAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007722
VALIDATED
ACKR3 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-142s1c1
Sequence:CCGGGCCTGGCAACTACTCTGACATCTCGAGATGTCAGAGTAGTTGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-462s1c1
Sequence:CCGGGCAAGATCACACACCTCATTTCTCGAGAAATGAGGTGTGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007722.2-249s1c1
Sequence:CCGGCCCTCTCCTTCATCTACATTTCTCGAGAAATGTAGATGAAGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007722.2-2308s1c1
Sequence:CCGGCCCACTGTCTACTCAGGAAATCTCGAGATTTCCTGAGTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007722.2-784s1c1
Sequence:CCGGCTTCACTATCATTGCGATCTTCTCGAGAAGATCGCAATGATAGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020311
ACKR3 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-181s1c1
Sequence:CCGGGCCAGGGAACTTCTCGGACATCTCGAGATGTCCGAGAAGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-288s1c1
Sequence:CCGGCGCTCTCCTTCATTTACATTTCTCGAGAAATGTAAATGAAGGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-901s1c1
Sequence:CCGGCCGGAAGATCATCTTCTCCTACTCGAGTAGGAGAAGATGATCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020311.1-1373s1c1
Sequence:CCGGCCCTGCATCCATTCTCTCTTTCTCGAGAAAGAGAGAATGGATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-375s21c1
Sequence:CCGGTCTTCGTCATCGGCATGATTGCTCGAGCAATCATGCCGATGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1652s21c1
Sequence:CCGGCACTATTGGTGTACCTTATAACTCGAGTTATAAGGTACACCAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1714s21c1
Sequence:CCGGGGCATAGTGCTGACATATATTCTCGAGAATATATGTCAGCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-878s21c1
Sequence:CCGGGCCGTTCCCTTCTCCATTATCCTCGAGGATAATGGAGAAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020311
ACKR3 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-181s1c1
Sequence:CCGGGCCAGGGAACTTCTCGGACATCTCGAGATGTCCGAGAAGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-288s1c1
Sequence:CCGGCGCTCTCCTTCATTTACATTTCTCGAGAAATGTAAATGAAGGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-901s1c1
Sequence:CCGGCCGGAAGATCATCTTCTCCTACTCGAGTAGGAGAAGATGATCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020311.1-1373s1c1
Sequence:CCGGCCCTGCATCCATTCTCTCTTTCTCGAGAAAGAGAGAATGGATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-375s21c1
Sequence:CCGGTCTTCGTCATCGGCATGATTGCTCGAGCAATCATGCCGATGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1652s21c1
Sequence:CCGGCACTATTGGTGTACCTTATAACTCGAGTTATAAGGTACACCAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1714s21c1
Sequence:CCGGGGCATAGTGCTGACATATATTCTCGAGAATATATGTCAGCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-878s21c1
Sequence:CCGGGCCGTTCCCTTCTCCATTATCCTCGAGGATAATGGAGAAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020311
ACKR3 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-181s1c1
Sequence:CCGGGCCAGGGAACTTCTCGGACATCTCGAGATGTCCGAGAAGTTCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-288s1c1
Sequence:CCGGCGCTCTCCTTCATTTACATTTCTCGAGAAATGTAAATGAAGGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020311.1-901s1c1
Sequence:CCGGCCGGAAGATCATCTTCTCCTACTCGAGTAGGAGAAGATGATCTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020311.1-1373s1c1
Sequence:CCGGCCCTGCATCCATTCTCTCTTTCTCGAGAAAGAGAGAATGGATGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-375s21c1
Sequence:CCGGTCTTCGTCATCGGCATGATTGCTCGAGCAATCATGCCGATGACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1652s21c1
Sequence:CCGGCACTATTGGTGTACCTTATAACTCGAGTTATAAGGTACACCAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020311.2-1714s21c1
Sequence:CCGGGGCATAGTGCTGACATATATTCTCGAGAATATATGTCAGCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020311.2-878s21c1
Sequence:CCGGGCCGTTCCCTTCTCCATTATCCTCGAGGATAATGGAGAAGGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks