EMAIL THIS PAGE TO A FRIEND

ACLY

ATP citrate lyase

108 Gene Product Result for
Synonyms: ACL ATPCL CLATP
UniProtKB ID: P53396, B4DIM0, Q13037, Q9BRL0
Gene ID:
Human(47) Summary: ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(104112) ATP citrate lyase
Rat(24159) ATP citrate lyase
chicken(395373) ATP citrate lyase
Horse(100053195) ATP citrate lyase
cow(511135) ATP citrate lyase
domestic cat(100422779) ATP citrate lyase
dog(607852) ATP citrate lyase
naked mole-rat(101700349) ATP citrate lyase
domestic guinea pig(100714933) ATP citrate lyase
sheep(654404) ATP citrate lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001096 Rosetta Predictions human pricing
NM_198830 Rosetta Predictions human pricing
NM_001111095 Rosetta Predictions rat pricing
NM_016987 Rosetta Predictions rat pricing
NM_134037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239323 predicted 832
2 SASI_Hs01_00239324 predicted 2537
3 SASI_Hs01_00239325 predicted 3371
4 SASI_Hs01_00239326 predicted 782
5 SASI_Hs01_00239327 predicted 2367
6 SASI_Hs01_00239328 predicted 3421
7 SASI_Hs01_00239329 predicted 3254
8 SASI_Hs01_00239330 predicted 909
9 SASI_Hs01_00239331 predicted 2523
10 SASI_Hs01_00239332 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169935 predicted 831
2 SASI_Hs01_00169936 predicted 2504
3 SASI_Hs01_00169937 predicted 3344
4 SASI_Hs01_00169938 predicted 783
5 SASI_Hs01_00169939 predicted 2337
6 SASI_Hs01_00169940 predicted 3387
7 SASI_Hs01_00169941 predicted 3225
8 SASI_Hs01_00169942 predicted 912
9 SASI_Hs01_00169943 predicted 2487
10 SASI_Hs01_00169944 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251472 predicted 604
2 SASI_Rn02_00251473 predicted 1964
3 SASI_Rn02_00251474 predicted 3164
4 SASI_Rn02_00251475 predicted 2464
5 SASI_Rn02_00251476 predicted 299
6 SASI_Rn02_00251477 predicted 3288
7 SASI_Rn02_00251478 predicted 795
8 SASI_Rn02_00251479 predicted 1275
9 SASI_Rn02_00251480 predicted 1003
10 SASI_Rn02_00251481 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085587 predicted 610
2 SASI_Rn01_00085588 predicted 1997
3 SASI_Rn01_00085589 predicted 3198
4 SASI_Rn01_00085591 predicted 2495
5 SASI_Rn01_00085592 predicted 299
6 SASI_Rn01_00085593 predicted 3317
7 SASI_Rn01_00085594 predicted 796
8 SASI_Rn02_00261121 predicted 1274
9 SASI_Rn01_00085595 predicted 1005
10 SASI_Rn01_00085596 predicted 1263
11 SASI_Rn01_00085590 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055653 predicted 290
2 SASI_Mm02_00339200 predicted 2944
3 SASI_Mm01_00055655 predicted 1167
4 SASI_Mm01_00055656 predicted 760
5 SASI_Mm01_00055658 predicted 617
6 SASI_Mm01_00055659 predicted 1978
7 SASI_Mm01_00055660 predicted 1280
8 SASI_Mm02_00339201 predicted 342
9 SASI_Mm02_00339202 predicted 3301
10 SASI_Mm01_00055661 predicted 1012
11 SASI_Mm01_00055654 predicted 2486
12 SASI_Mm01_00055657 predicted 1563
13 SASI_Mm01_00055662 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134037
ACLY MISSION shRNA Bacterial Glycerol Stock
ATP citrate lyase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-2924s1c1
Sequence:CCGGGCAGCAAAGATGTTCAGTAAACTCGAGTTTACTGAACATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3359s1c1
Sequence:CCGGCCCTGGGATGACATTTCCTATCTCGAGATAGGAAATGTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3242s1c1
Sequence:CCGGGCTGATGAATATGTTGACATTCTCGAGAATGTCAACATATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-706s1c1
Sequence:CCGGCGAGGATCTGTACTTCACCTACTCGAGTAGGTGAAGTACAGATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-1130s1c1
Sequence:CCGGGAAGGCAAGATCCTCATCATTCTCGAGAATGATGAGGATCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134037
ACLY MISSION shRNA shRNA Plasmid DNA
ATP citrate lyase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-2924s1c1
Sequence:CCGGGCAGCAAAGATGTTCAGTAAACTCGAGTTTACTGAACATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3359s1c1
Sequence:CCGGCCCTGGGATGACATTTCCTATCTCGAGATAGGAAATGTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3242s1c1
Sequence:CCGGGCTGATGAATATGTTGACATTCTCGAGAATGTCAACATATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-706s1c1
Sequence:CCGGCGAGGATCTGTACTTCACCTACTCGAGTAGGTGAAGTACAGATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-1130s1c1
Sequence:CCGGGAAGGCAAGATCCTCATCATTCTCGAGAATGATGAGGATCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134037
ACLY MISSION shRNA Lentiviral Transduction Particles
ATP citrate lyase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-2924s1c1
Sequence:CCGGGCAGCAAAGATGTTCAGTAAACTCGAGTTTACTGAACATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3359s1c1
Sequence:CCGGCCCTGGGATGACATTTCCTATCTCGAGATAGGAAATGTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-3242s1c1
Sequence:CCGGGCTGATGAATATGTTGACATTCTCGAGAATGTCAACATATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-706s1c1
Sequence:CCGGCGAGGATCTGTACTTCACCTACTCGAGTAGGTGAAGTACAGATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134037.2-1130s1c1
Sequence:CCGGGAAGGCAAGATCCTCATCATTCTCGAGAATGATGAGGATCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001096
VALIDATED
ACLY MISSION shRNA Bacterial Glycerol Stock
ATP citrate lyase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-3861s1c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-2809s1c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1234s1c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1110s1c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-2809s21c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1110s21c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001096.2-739s1c2
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-3861s21c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-739s21c1
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1234s21c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001096
VALIDATED
ACLY MISSION shRNA shRNA Plasmid DNA
ATP citrate lyase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-3861s1c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-2809s1c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1234s1c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1110s1c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-2809s21c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1110s21c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001096.2-739s1c2
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-3861s21c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-739s21c1
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1234s21c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001096
VALIDATED
ACLY MISSION shRNA Lentiviral Transduction Particles
ATP citrate lyase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-3861s1c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-2809s1c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1234s1c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001096.2-1110s1c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-2809s21c1
Sequence:CCGGGCCTAAGTACTCTTGCCAGTTCTCGAGAACTGGCAAGAGTACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1110s21c1
Sequence:CCGGCCTATGACTATGCCAAGACTACTCGAGTAGTCTTGGCATAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001096.2-739s1c2
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-3861s21c1
Sequence:CCGGGCCTCAAGATACTATACATTTCTCGAGAAATGTATAGTATCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-739s21c1
Sequence:CCGGCGAGGACTTGTACTTCACCTACTCGAGTAGGTGAAGTACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001096.2-1234s21c1
Sequence:CCGGCGTGAGAGCAATTCGAGATTACTCGAGTAATCTCGAATTGCTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks