EMAIL THIS PAGE TO A FRIEND

ACN9

ACN9 homolog (S. cerevisiae)

UniProtKB ID: Q9NRP4, A4D1J3, Q75MD6
Gene ID:
Mouse(71238) ACN9 homolog (S. cerevisiae)
Rat(362323) ACN9 homolog (S. cerevisiae)
Zebrafish(449654) ACN9 homolog (S. cerevisiae)
cow(783805) ACN9 homolog (S. cerevisiae)
chicken(420572) ACN9 homolog (S. cerevisiae)
dog(610248) ACN9 homolog (S. cerevisiae)
domestic cat(101095240) ACN9 homolog (S. cerevisiae)
naked mole-rat(101701799) ACN9 homolog (S. cerevisiae)
domestic guinea pig(100712763) ACN9 homolog (S. cerevisiae)
sheep(101119553) ACN9 homolog (S. cerevisiae)
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001077713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001077713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001077713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020186 Rosetta Predictions human pricing
NM_001047914 Rosetta Predictions rat pricing
NM_001077713 Rosetta Predictions mouse pricing
XM_355744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026057 predicted 1455
2 SASI_Hs02_00353104 predicted 1235
3 SASI_Hs01_00026059 predicted 1787
4 SASI_Hs01_00026061 predicted 1317
5 SASI_Hs01_00026063 predicted 1654
6 SASI_Hs01_00026064 predicted 1653
7 SASI_Hs01_00026065 predicted 1625
8 SASI_Hs02_00353105 predicted 1225
9 SASI_Hs02_00353106 predicted 1295
10 SASI_Hs02_00353107 predicted 1684
11 SASI_Hs01_00026058 predicted 662
12 SASI_Hs01_00026060 predicted 583
13 SASI_Hs01_00026062 predicted 448
14 SASI_Hs01_00026066 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206752 predicted 259
2 SASI_Rn02_00206753 predicted 136
3 SASI_Rn02_00206754 predicted 275
4 SASI_Rn02_00206755 predicted 252
5 SASI_Rn02_00206756 predicted 293
6 SASI_Rn02_00206757 predicted 283
7 SASI_Rn02_00206758 predicted 280
8 SASI_Rn02_00206759 predicted 159
9 SASI_Rn02_00206760 predicted 287
10 SASI_Rn02_00206761 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292962 predicted 252
2 SASI_Mm02_00292963 predicted 328
3 SASI_Mm02_00292964 predicted 213
4 SASI_Mm02_00292965 predicted 212
5 SASI_Mm02_00292966 predicted 275
6 SASI_Mm02_00292967 predicted 217
7 SASI_Mm02_00292968 predicted 320
8 SASI_Mm02_00292969 predicted 309
9 SASI_Mm02_00292970 predicted 306
10 SASI_Mm02_00292971 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275953 predicted 775
2 SASI_Mm01_00275954 predicted 770
3 SASI_Mm01_00275955 predicted 770
4 SASI_Mm01_00275956 predicted 711
5 SASI_Mm01_00275957 predicted 729
6 SASI_Mm01_00275958 predicted 601
7 SASI_Mm01_00275959 predicted 696
8 SASI_Mm01_00275960 predicted 634
9 SASI_Mm01_00275961 predicted 757
10 SASI_Mm01_00275962 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020186
VALIDATED
ACN9 MISSION shRNA Bacterial Glycerol Stock
ACN9 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-114s1c1
Sequence:CCGGGACCAGTACGTGAAAGACGAACTCGAGTTCGTCTTTCACGTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-117s1c1
Sequence:CCGGCAGTACGTGAAAGACGAATTTCTCGAGAAATTCGTCTTTCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-703s1c1
Sequence:CCGGGCTTCATCAAATAAGCATGTTCTCGAGAACATGCTTATTTGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-288s1c1
Sequence:CCGGCTTAATGACTTTCGTGATGAACTCGAGTTCATCACGAAAGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-294s1c1
Sequence:CCGGGACTTTCGTGATGAACAAATTCTCGAGAATTTGTTCATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-359s1c1
Sequence:CCGGGCAATTTAGTATTTCTGAGTCCTCGAGGACTCAGAAATACTAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-676s1c1
Sequence:CCGGCCATATTAGTCTTCTGGCTTTCTCGAGAAAGCCAGAAGACTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-169s1c1
Sequence:CCGGCACAGCGTTTCTTGCAAGAATCTCGAGATTCTTGCAAGAAACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-329s1c1
Sequence:CCGGGCTGATGCAAGAAGCCACAAACTCGAGTTTGTGGCTTCTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-205s1c1
Sequence:CCGGCAGCGTTATTGCAACAGGCTACTCGAGTAGCCTGTTGCAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-173s1c1
Sequence:CCGGGCGTTTCTTGCAAGAATGGGACTCGAGTCCCATTCTTGCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020186
VALIDATED
ACN9 MISSION shRNA shRNA Plasmid DNA
ACN9 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-114s1c1
Sequence:CCGGGACCAGTACGTGAAAGACGAACTCGAGTTCGTCTTTCACGTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-117s1c1
Sequence:CCGGCAGTACGTGAAAGACGAATTTCTCGAGAAATTCGTCTTTCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-703s1c1
Sequence:CCGGGCTTCATCAAATAAGCATGTTCTCGAGAACATGCTTATTTGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-288s1c1
Sequence:CCGGCTTAATGACTTTCGTGATGAACTCGAGTTCATCACGAAAGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-294s1c1
Sequence:CCGGGACTTTCGTGATGAACAAATTCTCGAGAATTTGTTCATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-359s1c1
Sequence:CCGGGCAATTTAGTATTTCTGAGTCCTCGAGGACTCAGAAATACTAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-676s1c1
Sequence:CCGGCCATATTAGTCTTCTGGCTTTCTCGAGAAAGCCAGAAGACTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-169s1c1
Sequence:CCGGCACAGCGTTTCTTGCAAGAATCTCGAGATTCTTGCAAGAAACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-329s1c1
Sequence:CCGGGCTGATGCAAGAAGCCACAAACTCGAGTTTGTGGCTTCTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-205s1c1
Sequence:CCGGCAGCGTTATTGCAACAGGCTACTCGAGTAGCCTGTTGCAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-173s1c1
Sequence:CCGGGCGTTTCTTGCAAGAATGGGACTCGAGTCCCATTCTTGCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020186
VALIDATED
ACN9 MISSION shRNA Lentiviral Transduction Particles
ACN9 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-114s1c1
Sequence:CCGGGACCAGTACGTGAAAGACGAACTCGAGTTCGTCTTTCACGTACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-117s1c1
Sequence:CCGGCAGTACGTGAAAGACGAATTTCTCGAGAAATTCGTCTTTCACGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-703s1c1
Sequence:CCGGGCTTCATCAAATAAGCATGTTCTCGAGAACATGCTTATTTGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-288s1c1
Sequence:CCGGCTTAATGACTTTCGTGATGAACTCGAGTTCATCACGAAAGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-294s1c1
Sequence:CCGGGACTTTCGTGATGAACAAATTCTCGAGAATTTGTTCATCACGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-359s1c1
Sequence:CCGGGCAATTTAGTATTTCTGAGTCCTCGAGGACTCAGAAATACTAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020186.1-676s1c1
Sequence:CCGGCCATATTAGTCTTCTGGCTTTCTCGAGAAAGCCAGAAGACTAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-169s1c1
Sequence:CCGGCACAGCGTTTCTTGCAAGAATCTCGAGATTCTTGCAAGAAACGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020186.1-329s1c1
Sequence:CCGGGCTGATGCAAGAAGCCACAAACTCGAGTTTGTGGCTTCTTGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-205s1c1
Sequence:CCGGCAGCGTTATTGCAACAGGCTACTCGAGTAGCCTGTTGCAATAACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020186.1-173s1c1
Sequence:CCGGGCGTTTCTTGCAAGAATGGGACTCGAGTCCCATTCTTGCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077713
VALIDATED
ACN9 MISSION shRNA Bacterial Glycerol Stock
ACN9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-354s21c1
Sequence:CCGGTAGTATCACTGAGTCTACAAACTCGAGTTTGTAGACTCAGTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-380s21c1
Sequence:CCGGAGTTGTGATACATGATCTTAACTCGAGTTAAGATCATGTATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-319s21c1
Sequence:CCGGCTGATGCAAGAGGCTACTAAACTCGAGTTTAGTAGCCTCTTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-283s21c1
Sequence:CCGGGACTTTCGTGATGAGCAAATTCTCGAGAATTTGCTCATCACGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-107s21c1
Sequence:CCGGAGTACGTGAAGGACGAATTTACTCGAGTAAATTCGTCCTTCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077713
VALIDATED
ACN9 MISSION shRNA shRNA Plasmid DNA
ACN9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-354s21c1
Sequence:CCGGTAGTATCACTGAGTCTACAAACTCGAGTTTGTAGACTCAGTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-380s21c1
Sequence:CCGGAGTTGTGATACATGATCTTAACTCGAGTTAAGATCATGTATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-319s21c1
Sequence:CCGGCTGATGCAAGAGGCTACTAAACTCGAGTTTAGTAGCCTCTTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-283s21c1
Sequence:CCGGGACTTTCGTGATGAGCAAATTCTCGAGAATTTGCTCATCACGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-107s21c1
Sequence:CCGGAGTACGTGAAGGACGAATTTACTCGAGTAAATTCGTCCTTCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077713
VALIDATED
ACN9 MISSION shRNA Lentiviral Transduction Particles
ACN9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-354s21c1
Sequence:CCGGTAGTATCACTGAGTCTACAAACTCGAGTTTGTAGACTCAGTGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-380s21c1
Sequence:CCGGAGTTGTGATACATGATCTTAACTCGAGTTAAGATCATGTATCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-319s21c1
Sequence:CCGGCTGATGCAAGAGGCTACTAAACTCGAGTTTAGTAGCCTCTTGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-283s21c1
Sequence:CCGGGACTTTCGTGATGAGCAAATTCTCGAGAATTTGCTCATCACGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077713.1-107s21c1
Sequence:CCGGAGTACGTGAAGGACGAATTTACTCGAGTAAATTCGTCCTTCACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks