EMAIL THIS PAGE TO A FRIEND

ACO1

aconitase 1, soluble

154 Gene Product Result for
Synonyms: ACONS IREB1 IREBP IREBP1 IRP1
UniProtKB ID: P21399, D3DRK7, Q14652, Q5VZA7
Gene ID:
Human(48) Summary: The protein encoded by this gene is a bifunctional, cytosolic protein that functions as an essential enzyme in the TCA cycle and interacts with mRNA to control the levels of iron inside cells. When cellular iron levels are high, this protein binds to a 4Fe-4S cluster and functions as an aconitase. Aconitases are iron-sulfur proteins that function to catalyze the conversion of citrate to isocitrate. When cellular iron levels are low, the protein binds to iron-responsive elements (IREs), which are stem-loop structures found in the 5' UTR of ferritin mRNA, and in the 3' UTR of transferrin receptor mRNA. When the protein binds to IRE, it results in repression of translation of ferritin mRNA, and inhibition of degradation of the otherwise rapidly degraded transferrin receptor mRNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(11428) aconitase 1
Rat(50655) aconitase 1, soluble
Zebrafish(568448) aconitase 1, soluble
cow(512995) aconitase 1, soluble
Horse(100067866) aconitase 1, soluble
domestic cat(101095526) aconitase 1, soluble
dog(481576) aconitase 1, soluble
chicken(373916) aconitase 1, soluble
Thale Cress(816478) 1-aminocyclopropane-1-carboxylate oxidase 1
Thale Cress(829737) aconitate hydratase 1
domestic guinea pig(100720793) aconitase 1, soluble
naked mole-rat(101716545) aconitase 1, soluble
sheep(101112791) aconitase 1, soluble
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5859 Anti-ACO1 (406-420) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A5984 Anti-ACO1 (536-550) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501279 Anti-ACO1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1405419 Anti-ACO1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV40390 Anti-ACO1 antibody produced in rabbit affinity isolated antibody bovine, human, rabbit, rabbit, canine, guinea pig, rat, horse
immunohistochemistry, western blot pricing
HPA024157 Anti-ACO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
HPA019371 Anti-ACO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501999 Anti-IREB1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4502000 Anti-IREB1, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504247 Anti-phospho-IREB1 (pSer711) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0000048M1 Monoclonal Anti-ACO1 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403517 Monoclonal Anti-ACO1, (C-terminal) antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK051 Aconitase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002197 Rosetta Predictions human pricing
NM_017321 Rosetta Predictions rat pricing
XM_579410 Rosetta Predictions rat pricing
NM_007386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138944 predicted 1377
2 SASI_Hs01_00138945 predicted 2580
3 SASI_Hs01_00138946 predicted 2564
4 SASI_Hs01_00138947 predicted 1632
5 SASI_Hs02_00333420 predicted 2657
6 SASI_Hs01_00138948 predicted 2322
7 SASI_Hs01_00138949 predicted 1968
8 SASI_Hs01_00138950 predicted 675
9 SASI_Hs01_00138951 predicted 378
10 SASI_Hs01_00138952 predicted 781
11 SASI_Hs01_00138953 predicted 2601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113321 predicted 2247
2 SASI_Rn01_00113323 predicted 319
3 SASI_Rn01_00113324 predicted 479
4 SASI_Rn02_00261771 predicted 794
5 SASI_Rn01_00113325 predicted 757
6 SASI_Rn01_00113326 predicted 425
7 SASI_Rn01_00113328 predicted 1462
8 SASI_Rn01_00113329 predicted 2229
9 SASI_Rn01_00113330 predicted 860
10 SASI_Rn02_00261772 predicted 1994
11 SASI_Rn01_00113322 predicted 244
12 SASI_Rn01_00113327 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177466 predicted 1717
2 SASI_Rn01_00177467 predicted 771
3 SASI_Rn01_00177468 predicted 679
4 SASI_Rn01_00177469 predicted 1834
5 SASI_Rn01_00177470 predicted 1830
6 SASI_Rn01_00177471 predicted 1752
7 SASI_Rn01_00177472 predicted 1811
8 SASI_Rn01_00177473 predicted 719
9 SASI_Rn01_00177474 predicted 1853
10 SASI_Rn01_00177475 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178675 predicted 486
2 SASI_Mm01_00178676 predicted 2902
3 SASI_Mm01_00178677 predicted 2238
4 SASI_Mm01_00178678 predicted 446
5 SASI_Mm01_00178680 predicted 1114
6 SASI_Mm01_00178681 predicted 935
7 SASI_Mm01_00178682 predicted 917
8 SASI_Mm01_00178683 predicted 2312
9 SASI_Mm01_00178684 predicted 2298
10 SASI_Mm02_00311492 predicted 2319
11 SASI_Mm01_00178679 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007386
VALIDATED
ACO1 MISSION shRNA Bacterial Glycerol Stock
aconitase 1, soluble
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-3148s1c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-480s1c1
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-318s1c1
Sequence:CCGGCGAGTCATACTGCAAGACTTTCTCGAGAAAGTCTTGCAGTATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-950s1c1
Sequence:CCGGCCGAGCTACGATTGCCAATATCTCGAGATATTGGCAATCGTAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-1769s1c1
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007386.2-3382s21c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-2002s21c2
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-1324s21c1
Sequence:CCGGTGTAGGCATGTTTCGAGATTTCTCGAGAAATCTCGAAACATGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-523s21c1
Sequence:CCGGGAACATAGAAGTGCCGTTTAACTCGAGTTAAACGGCACTTCTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-713s21c3
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007386
VALIDATED
ACO1 MISSION shRNA shRNA Plasmid DNA
aconitase 1, soluble
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-3148s1c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-480s1c1
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-318s1c1
Sequence:CCGGCGAGTCATACTGCAAGACTTTCTCGAGAAAGTCTTGCAGTATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-950s1c1
Sequence:CCGGCCGAGCTACGATTGCCAATATCTCGAGATATTGGCAATCGTAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-1769s1c1
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007386.2-3382s21c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-2002s21c2
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-1324s21c1
Sequence:CCGGTGTAGGCATGTTTCGAGATTTCTCGAGAAATCTCGAAACATGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-523s21c1
Sequence:CCGGGAACATAGAAGTGCCGTTTAACTCGAGTTAAACGGCACTTCTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-713s21c3
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007386
VALIDATED
ACO1 MISSION shRNA Lentiviral Transduction Particles
aconitase 1, soluble
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-3148s1c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-480s1c1
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-318s1c1
Sequence:CCGGCGAGTCATACTGCAAGACTTTCTCGAGAAAGTCTTGCAGTATGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-950s1c1
Sequence:CCGGCCGAGCTACGATTGCCAATATCTCGAGATATTGGCAATCGTAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007386.1-1769s1c1
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007386.2-3382s21c1
Sequence:CCGGCGTGTATTACACCAGTGTTAACTCGAGTTAACACTGGTGTAATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-2002s21c2
Sequence:CCGGCGTCAGGATTGACTTCGAGAACTCGAGTTCTCGAAGTCAATCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-1324s21c1
Sequence:CCGGTGTAGGCATGTTTCGAGATTTCTCGAGAAATCTCGAAACATGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-523s21c1
Sequence:CCGGGAACATAGAAGTGCCGTTTAACTCGAGTTAAACGGCACTTCTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007386.2-713s21c3
Sequence:CCGGGCAGACAGTTTACAGAAGAATCTCGAGATTCTTCTGTAAACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002197
VALIDATED
ACO1 MISSION shRNA Bacterial Glycerol Stock
aconitase 1, soluble
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-156s1c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-462s1c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1452s1c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-2029s1c1
Sequence:CCGGCGTATATCAAATCACCACCATCTCGAGATGGTGGTGATTTGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1550s1c1
Sequence:CCGGCCTACAAGAAAGCGGAGTCATCTCGAGATGACTCCGCTTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002197.2-3227s21c1
Sequence:CCGGCCTTCCTCTTGAGGGTCATTTCTCGAGAAATGACCCTCAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-510s21c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-204s21c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002197.2-1500s21c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002197
VALIDATED
ACO1 MISSION shRNA shRNA Plasmid DNA
aconitase 1, soluble
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-156s1c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-462s1c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1452s1c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-2029s1c1
Sequence:CCGGCGTATATCAAATCACCACCATCTCGAGATGGTGGTGATTTGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1550s1c1
Sequence:CCGGCCTACAAGAAAGCGGAGTCATCTCGAGATGACTCCGCTTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002197.2-3227s21c1
Sequence:CCGGCCTTCCTCTTGAGGGTCATTTCTCGAGAAATGACCCTCAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-510s21c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-204s21c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002197.2-1500s21c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002197
VALIDATED
ACO1 MISSION shRNA Lentiviral Transduction Particles
aconitase 1, soluble
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-156s1c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-462s1c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1452s1c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-2029s1c1
Sequence:CCGGCGTATATCAAATCACCACCATCTCGAGATGGTGGTGATTTGATATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002197.1-1550s1c1
Sequence:CCGGCCTACAAGAAAGCGGAGTCATCTCGAGATGACTCCGCTTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002197.2-3227s21c1
Sequence:CCGGCCTTCCTCTTGAGGGTCATTTCTCGAGAAATGACCCTCAAGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-510s21c1
Sequence:CCGGCCTGCTGATCTTGTAATAGATCTCGAGATCTATTACAAGATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002197.2-204s21c1
Sequence:CCGGCCAGGAAAGAAATTCTTCAATCTCGAGATTGAAGAATTTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002197.2-1500s21c1
Sequence:CCGGGCAGGATTGTTAGCAAAGAAACTCGAGTTTCTTTGCTAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks