EMAIL THIS PAGE TO A FRIEND

ACO2

aconitase 2, mitochondrial

54 Gene Product Result for
Synonyms: ACONM ICRD
UniProtKB ID: Q99798, O75809, Q5JZ41, Q6FHX0, Q8TAQ6
Gene ID:
Human(50) Summary: The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Mouse(11429) aconitase 2, mitochondrial
Rat(79250) aconitase 2, mitochondrial
sheep(101103148) aconitase 2, mitochondrial
naked mole-rat(101705755) aconitase 2, mitochondrial
domestic guinea pig(100716169) aconitase 2, mitochondrial
Zebrafish(322670) aconitase 2, mitochondrial
Thale Cress(842536) 1-aminocyclopropane-1-carboxylate oxidase 2
chicken(374009) aconitase 2, mitochondrial
cow(280976) aconitase 2, mitochondrial
domestic cat(101101395) aconitase 2, mitochondrial
dog(474487) aconitase 2, mitochondrial
Thale Cress(828805) aconitase 2
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK051 Aconitase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098 Rosetta Predictions human pricing
NM_024398 Rosetta Predictions rat pricing
NM_080633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072936 predicted 497
2 SASI_Hs01_00072937 predicted 1007
3 SASI_Hs01_00072938 predicted 968
4 SASI_Hs01_00072940 predicted 1493
5 SASI_Hs02_00318576 predicted 866
6 SASI_Hs01_00072941 predicted 969
7 SASI_Hs01_00072942 predicted 1297
8 SASI_Hs01_00072943 predicted 1055
9 SASI_Hs01_00072944 predicted 1767
10 SASI_Hs02_00318577 predicted 1294
11 SASI_Hs01_00072935 predicted 1178
12 SASI_Hs01_00072939 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041015 predicted 1222
2 SASI_Rn01_00041016 predicted 951
3 SASI_Rn01_00041017 predicted 995
4 SASI_Rn01_00041018 predicted 474
5 SASI_Rn01_00041019 predicted 1525
6 SASI_Rn01_00041020 predicted 1007
7 SASI_Rn01_00041021 predicted 1472
8 SASI_Rn01_00041022 predicted 1436
9 SASI_Rn02_00263997 predicted 1744
10 SASI_Rn01_00041023 predicted 1990
11 SASI_Rn01_00041024 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152001 predicted 1045
2 SASI_Mm02_00338177 predicted 999
3 SASI_Mm01_00152002 predicted 804
4 SASI_Mm01_00152003 predicted 518
5 SASI_Mm01_00152004 predicted 558
6 SASI_Mm01_00152005 predicted 1795
7 SASI_Mm01_00152006 predicted 1452
8 SASI_Mm01_00152007 predicted 827
9 SASI_Mm01_00152008 predicted 1527
10 SASI_Mm01_00152010 predicted 480
11 SASI_Mm01_00152009 predicted 2023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098
VALIDATED
ACO2 MISSION shRNA Bacterial Glycerol Stock
aconitase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-803s21c1
Sequence:CCGGACAGGTGCAATCGTGGAATACCTCGAGGTATTCCACGATTGCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-138s21c1
Sequence:CCGGCCAACGAGTACATCCATTATGCTCGAGCATAATGGATGTACTCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-534s21c1
Sequence:CCGGGAATCATTCACCAGATTATTCCTCGAGGAATAATCTGGTGAATGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-160s21c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-1148s21c1
Sequence:CCGGGACATCCGAGTGGGTCTAATTCTCGAGAATTAGACCCACTCGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-137s1c1
Sequence:CCGGCCCAACGAGTACATCCATTATCTCGAGATAATGGATGTACTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-1961s1c1
Sequence:CCGGGCCCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-160s1c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-2156s1c1
Sequence:CCGGCCGGCTGACTACAACAAGATTCTCGAGAATCTTGTTGTAGTCAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001098.2-1014s1c1
Sequence:CCGGGCTGCCATTATGACCAACTAACTCGAGTTAGTTGGTCATAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098
VALIDATED
ACO2 MISSION shRNA shRNA Plasmid DNA
aconitase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-803s21c1
Sequence:CCGGACAGGTGCAATCGTGGAATACCTCGAGGTATTCCACGATTGCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-138s21c1
Sequence:CCGGCCAACGAGTACATCCATTATGCTCGAGCATAATGGATGTACTCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-534s21c1
Sequence:CCGGGAATCATTCACCAGATTATTCCTCGAGGAATAATCTGGTGAATGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-160s21c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-1148s21c1
Sequence:CCGGGACATCCGAGTGGGTCTAATTCTCGAGAATTAGACCCACTCGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-137s1c1
Sequence:CCGGCCCAACGAGTACATCCATTATCTCGAGATAATGGATGTACTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-1961s1c1
Sequence:CCGGGCCCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-160s1c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-2156s1c1
Sequence:CCGGCCGGCTGACTACAACAAGATTCTCGAGAATCTTGTTGTAGTCAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001098.2-1014s1c1
Sequence:CCGGGCTGCCATTATGACCAACTAACTCGAGTTAGTTGGTCATAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098
VALIDATED
ACO2 MISSION shRNA Lentiviral Transduction Particles
aconitase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-803s21c1
Sequence:CCGGACAGGTGCAATCGTGGAATACCTCGAGGTATTCCACGATTGCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-138s21c1
Sequence:CCGGCCAACGAGTACATCCATTATGCTCGAGCATAATGGATGTACTCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-534s21c1
Sequence:CCGGGAATCATTCACCAGATTATTCCTCGAGGAATAATCTGGTGAATGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-160s21c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098.2-1148s21c1
Sequence:CCGGGACATCCGAGTGGGTCTAATTCTCGAGAATTAGACCCACTCGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-137s1c1
Sequence:CCGGCCCAACGAGTACATCCATTATCTCGAGATAATGGATGTACTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-1961s1c1
Sequence:CCGGGCCCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-160s1c1
Sequence:CCGGCCTGCTAGAGAAGAACATTAACTCGAGTTAATGTTCTTCTCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001098.2-2156s1c1
Sequence:CCGGCCGGCTGACTACAACAAGATTCTCGAGAATCTTGTTGTAGTCAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001098.2-1014s1c1
Sequence:CCGGGCTGCCATTATGACCAACTAACTCGAGTTAGTTGGTCATAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080633
VALIDATED
ACO2 MISSION shRNA Bacterial Glycerol Stock
aconitase 2, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-942s21c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-2184s21c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-165s21c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080633.2-2626s21c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-1989s21c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080633.1-2652s1c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-968s1c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2015s1c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2210s1c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-191s1c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080633
VALIDATED
ACO2 MISSION shRNA shRNA Plasmid DNA
aconitase 2, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-942s21c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-2184s21c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-165s21c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080633.2-2626s21c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-1989s21c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080633.1-2652s1c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-968s1c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2015s1c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2210s1c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-191s1c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080633
VALIDATED
ACO2 MISSION shRNA Lentiviral Transduction Particles
aconitase 2, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-942s21c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-2184s21c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-165s21c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080633.2-2626s21c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080633.2-1989s21c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080633.1-2652s1c1
Sequence:CCGGCCCATGCAACTGTATTTATTTCTCGAGAAATAAATACAGTTGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-968s1c1
Sequence:CCGGCCATACAACCACAGGATGAAACTCGAGTTTCATCCTGTGGTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2015s1c1
Sequence:CCGGGCTCGCTACTACAAGAAACATCTCGAGATGTTTCTTGTAGTAGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-2210s1c1
Sequence:CCGGCCCTCCGACTATAACAAGATTCTCGAGAATCTTGTTATAGTCGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080633.1-191s1c1
Sequence:CCGGCCCAGTGAGTACATCCGATATCTCGAGATATCGGATGTACTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)