EMAIL THIS PAGE TO A FRIEND

ACOT11

acyl-CoA thioesterase 11

125 Gene Product Result for
Synonyms: BFIT STARD14 THEA THEM1
Gene ID:
Human(26027) Summary: This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
Mouse(329910) acyl-CoA thioesterase 11
Rat(100363074) acyl-CoA thioesterase 11
naked mole-rat(101697756) acyl-CoA thioesterase 11
domestic guinea pig(100733760) acyl-CoA thioesterase 11
sheep(101118240) acyl-CoA thioesterase 11
chicken(429108) acyl-CoA thioesterase 11
domestic cat(101097501) acyl-CoA thioesterase 11
Horse(100060460) acyl-CoA thioesterase 11
cow(533609) acyl-CoA thioesterase 11
dog(489576) acyl-CoA thioesterase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015547 Rosetta Predictions human pricing
NM_147161 Rosetta Predictions human pricing
NM_025590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209756 predicted 921
2 SASI_Hs01_00209757 predicted 357
3 SASI_Hs01_00209758 predicted 1317
4 SASI_Hs01_00209759 predicted 926
5 SASI_Hs01_00209760 predicted 676
6 SASI_Hs01_00209761 predicted 855
7 SASI_Hs01_00209762 predicted 876
8 SASI_Hs01_00209763 predicted 1231
9 SASI_Hs01_00209764 predicted 379
10 SASI_Hs01_00209765 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060374 predicted 915
2 SASI_Hs01_00060375 predicted 354
3 SASI_Hs01_00060376 predicted 1314
4 SASI_Hs01_00060377 predicted 923
5 SASI_Hs01_00060378 predicted 676
6 SASI_Hs01_00060379 predicted 859
7 SASI_Hs01_00060380 predicted 874
8 SASI_Hs01_00060381 predicted 1229
9 SASI_Hs01_00060382 predicted 378
10 SASI_Hs01_00060383 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087267 predicted 988
2 SASI_Mm01_00087268 predicted 334
3 SASI_Mm01_00087269 predicted 337
4 SASI_Mm01_00087270 predicted 675
5 SASI_Mm02_00328582 predicted 1744
6 SASI_Mm02_00328583 predicted 328
7 SASI_Mm01_00087271 predicted 427
8 SASI_Mm01_00087272 predicted 698
9 SASI_Mm01_00087274 predicted 640
10 SASI_Mm01_00087275 predicted 1867
11 SASI_Mm01_00087273 predicted 1051
12 SASI_Mm01_00087276 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025590
ACOT11 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-1220s1c1
Sequence:CCGGCTACAACGTGTCCTCTCTGAACTCGAGTTCAGAGAGGACACGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-357s1c1
Sequence:CCGGCATACCATTAGTGTCGGCCAACTCGAGTTGGCCGACACTAATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-621s1c1
Sequence:CCGGGACACCATCAAAGATCTCCTACTCGAGTAGGAGATCTTTGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-5035s1c1
Sequence:CCGGCCAAAGTTTCAGATTCCTAATCTCGAGATTAGGAATCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-3329s1c1
Sequence:CCGGCCTGACATTCAACAGAATTTACTCGAGTAAATTCTGTTGAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-94s1c1
Sequence:CCGGCTATGTTCTCTAATCGCACATCTCGAGATGTGCGATTAGAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-1670s1c1
Sequence:CCGGGATGACTAAGGTTTCTTACTACTCGAGTAGTAAGAAACCTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025590
ACOT11 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-1220s1c1
Sequence:CCGGCTACAACGTGTCCTCTCTGAACTCGAGTTCAGAGAGGACACGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-357s1c1
Sequence:CCGGCATACCATTAGTGTCGGCCAACTCGAGTTGGCCGACACTAATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-621s1c1
Sequence:CCGGGACACCATCAAAGATCTCCTACTCGAGTAGGAGATCTTTGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-5035s1c1
Sequence:CCGGCCAAAGTTTCAGATTCCTAATCTCGAGATTAGGAATCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-3329s1c1
Sequence:CCGGCCTGACATTCAACAGAATTTACTCGAGTAAATTCTGTTGAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-94s1c1
Sequence:CCGGCTATGTTCTCTAATCGCACATCTCGAGATGTGCGATTAGAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-1670s1c1
Sequence:CCGGGATGACTAAGGTTTCTTACTACTCGAGTAGTAAGAAACCTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025590
ACOT11 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-1220s1c1
Sequence:CCGGCTACAACGTGTCCTCTCTGAACTCGAGTTCAGAGAGGACACGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025590.3-357s1c1
Sequence:CCGGCATACCATTAGTGTCGGCCAACTCGAGTTGGCCGACACTAATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-621s1c1
Sequence:CCGGGACACCATCAAAGATCTCCTACTCGAGTAGGAGATCTTTGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-5035s1c1
Sequence:CCGGCCAAAGTTTCAGATTCCTAATCTCGAGATTAGGAATCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025590.3-3329s1c1
Sequence:CCGGCCTGACATTCAACAGAATTTACTCGAGTAAATTCTGTTGAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-94s1c1
Sequence:CCGGCTATGTTCTCTAATCGCACATCTCGAGATGTGCGATTAGAGAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025590.3-1670s1c1
Sequence:CCGGGATGACTAAGGTTTCTTACTACTCGAGTAGTAAGAAACCTTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015547
ACOT11 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-634s1c1
Sequence:CCGGCCTTGTCTATGCAGACACCATCTCGAGATGGTGTCTGCATAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-538s1c1
Sequence:CCGGCCGAGAGATCACCAAGGTGAACTCGAGTTCACCTTGGTGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-940s1c1
Sequence:CCGGCATCGTGAACAATGCCTTCAACTCGAGTTGAAGGCATTGTTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-1746s1c1
Sequence:CCGGTCTCGGCAAGTGGCTTCTATTCTCGAGAATAGAAGCCACTTGCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015547.2-777s21c1
Sequence:CCGGATCACCAGGGCAACACCTTTGCTCGAGCAAAGGTGTTGCCCTGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015547
ACOT11 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-634s1c1
Sequence:CCGGCCTTGTCTATGCAGACACCATCTCGAGATGGTGTCTGCATAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-538s1c1
Sequence:CCGGCCGAGAGATCACCAAGGTGAACTCGAGTTCACCTTGGTGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-940s1c1
Sequence:CCGGCATCGTGAACAATGCCTTCAACTCGAGTTGAAGGCATTGTTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-1746s1c1
Sequence:CCGGTCTCGGCAAGTGGCTTCTATTCTCGAGAATAGAAGCCACTTGCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015547.2-777s21c1
Sequence:CCGGATCACCAGGGCAACACCTTTGCTCGAGCAAAGGTGTTGCCCTGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015547
ACOT11 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-634s1c1
Sequence:CCGGCCTTGTCTATGCAGACACCATCTCGAGATGGTGTCTGCATAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-538s1c1
Sequence:CCGGCCGAGAGATCACCAAGGTGAACTCGAGTTCACCTTGGTGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-940s1c1
Sequence:CCGGCATCGTGAACAATGCCTTCAACTCGAGTTGAAGGCATTGTTCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015547.2-1746s1c1
Sequence:CCGGTCTCGGCAAGTGGCTTCTATTCTCGAGAATAGAAGCCACTTGCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015547.2-777s21c1
Sequence:CCGGATCACCAGGGCAACACCTTTGCTCGAGCAAAGGTGTTGCCCTGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks