EMAIL THIS PAGE TO A FRIEND

ACOT12

acyl-CoA thioesterase 12

51 Gene Product Result for
Synonyms: CACH-1 Cach STARD15 THEAL
UniProtKB ID: Q8WYK0, B3KVK9
Gene ID:
Mouse(74156) acyl-CoA thioesterase 12
Rat(170570) acyl-CoA thioesterase 12
chicken(431627) acyl-CoA thioesterase 12
dog(488925) acyl-CoA thioesterase 12
Horse(100073251) acyl-CoA thioesterase 12
cow(525155) acyl-CoA thioesterase 12
domestic cat(101091423) acyl-CoA thioesterase 12
sheep(101118188) acyl-CoA thioesterase 12
Domestic Rabbit(100338318) acyl-CoA thioesterase 12
domestic guinea pig(100729776) acyl-CoA thioesterase 12
naked mole-rat(101703913) acyl-CoA thioesterase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002581 MISSION® esiRNA esiRNA targeting human ACOT12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130767 Rosetta Predictions human pricing
NM_130747 Rosetta Predictions rat pricing
NM_028790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362782 predicted 1652
2 SASI_Hs01_00133060 predicted 279
3 SASI_Hs01_00133061 predicted 1250
4 SASI_Hs01_00133062 predicted 475
5 SASI_Hs01_00133063 predicted 308
6 SASI_Hs01_00133064 predicted 1051
7 SASI_Hs01_00133066 predicted 1564
8 SASI_Hs01_00133067 predicted 1325
9 SASI_Hs01_00133068 predicted 300
10 SASI_Hs02_00362783 predicted 1557
11 SASI_Hs01_00133065 predicted 475
12 SASI_Hs01_00133069 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038110 predicted 996
2 SASI_Rn01_00038111 predicted 1374
3 SASI_Rn01_00038112 predicted 243
4 SASI_Rn01_00038113 predicted 880
5 SASI_Rn01_00038114 predicted 1182
6 SASI_Rn01_00038115 predicted 1410
7 SASI_Rn01_00038116 predicted 920
8 SASI_Rn02_00267479 predicted 466
9 SASI_Rn01_00038117 predicted 1273
10 SASI_Rn01_00038118 predicted 749
11 SASI_Rn01_00038119 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190334 predicted 1308
2 SASI_Mm01_00190335 predicted 205
3 SASI_Mm01_00190336 predicted 239
4 SASI_Mm01_00190337 predicted 1702
5 SASI_Mm01_00190338 predicted 912
6 SASI_Mm01_00190339 predicted 1639
7 SASI_Mm01_00190340 predicted 1269
8 SASI_Mm01_00190341 predicted 1669
9 SASI_Mm01_00190342 predicted 1352
10 SASI_Mm01_00190343 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130767
ACOT12 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 12
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130767.2-653s21c1
Sequence:CCGGACATTTGGTGGCCAGATTATGCTCGAGCATAATCTGGCCACCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1402s1c1
Sequence:CCGGCCCTCAAAGATGGTAACACTTCTCGAGAAGTGTTACCATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1470s1c1
Sequence:CCGGCCACAGTACATCAGAAGTGAACTCGAGTTCACTTCTGATGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-768s1c1
Sequence:CCGGGCCATTGTCAACAATACATTTCTCGAGAAATGTATTGTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1574s1c1
Sequence:CCGGCCTTCCTTACTTTGCTGGAAACTCGAGTTTCCAGCAAAGTAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-150s1c1
Sequence:CCGGGCTGAGAAACATGCTGGAGTTCTCGAGAACTCCAGCATGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130767
ACOT12 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 12
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130767.2-653s21c1
Sequence:CCGGACATTTGGTGGCCAGATTATGCTCGAGCATAATCTGGCCACCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1402s1c1
Sequence:CCGGCCCTCAAAGATGGTAACACTTCTCGAGAAGTGTTACCATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1470s1c1
Sequence:CCGGCCACAGTACATCAGAAGTGAACTCGAGTTCACTTCTGATGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-768s1c1
Sequence:CCGGGCCATTGTCAACAATACATTTCTCGAGAAATGTATTGTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1574s1c1
Sequence:CCGGCCTTCCTTACTTTGCTGGAAACTCGAGTTTCCAGCAAAGTAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-150s1c1
Sequence:CCGGGCTGAGAAACATGCTGGAGTTCTCGAGAACTCCAGCATGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130767
ACOT12 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 12
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130767.2-653s21c1
Sequence:CCGGACATTTGGTGGCCAGATTATGCTCGAGCATAATCTGGCCACCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1402s1c1
Sequence:CCGGCCCTCAAAGATGGTAACACTTCTCGAGAAGTGTTACCATCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1470s1c1
Sequence:CCGGCCACAGTACATCAGAAGTGAACTCGAGTTCACTTCTGATGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-768s1c1
Sequence:CCGGGCCATTGTCAACAATACATTTCTCGAGAAATGTATTGTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-1574s1c1
Sequence:CCGGCCTTCCTTACTTTGCTGGAAACTCGAGTTTCCAGCAAAGTAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130767.1-150s1c1
Sequence:CCGGGCTGAGAAACATGCTGGAGTTCTCGAGAACTCCAGCATGTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028790
ACOT12 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028790.3-1891s21c1
Sequence:CCGGTACGATATCACATGATCTATACTCGAGTATAGATCATGTGATATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1029s21c1
Sequence:CCGGTCAGTGCACAGTGGGATATAACTCGAGTTATATCCCACTGTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1568s21c1
Sequence:CCGGCCTTACTTTGCTGGCAATATTCTCGAGAATATTGCCAGCAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1301s21c1
Sequence:CCGGAGCGAGGACGATCAGATATATCTCGAGATATATCTGATCGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-204s21c1
Sequence:CCGGCAGCGAGAATTGGACAAATTACTCGAGTAATTTGTCCAATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-270s1c1
Sequence:CCGGGAGATCAGTATCAAGGTCATACTCGAGTATGACCTTGATACTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-1174s1c1
Sequence:CCGGCCATATCTGTTAAGGTTGAAACTCGAGTTTCAACCTTAACAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028790
ACOT12 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028790.3-1891s21c1
Sequence:CCGGTACGATATCACATGATCTATACTCGAGTATAGATCATGTGATATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1029s21c1
Sequence:CCGGTCAGTGCACAGTGGGATATAACTCGAGTTATATCCCACTGTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1568s21c1
Sequence:CCGGCCTTACTTTGCTGGCAATATTCTCGAGAATATTGCCAGCAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1301s21c1
Sequence:CCGGAGCGAGGACGATCAGATATATCTCGAGATATATCTGATCGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-204s21c1
Sequence:CCGGCAGCGAGAATTGGACAAATTACTCGAGTAATTTGTCCAATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-270s1c1
Sequence:CCGGGAGATCAGTATCAAGGTCATACTCGAGTATGACCTTGATACTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-1174s1c1
Sequence:CCGGCCATATCTGTTAAGGTTGAAACTCGAGTTTCAACCTTAACAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028790
ACOT12 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028790.3-1891s21c1
Sequence:CCGGTACGATATCACATGATCTATACTCGAGTATAGATCATGTGATATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1029s21c1
Sequence:CCGGTCAGTGCACAGTGGGATATAACTCGAGTTATATCCCACTGTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1568s21c1
Sequence:CCGGCCTTACTTTGCTGGCAATATTCTCGAGAATATTGCCAGCAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-1301s21c1
Sequence:CCGGAGCGAGGACGATCAGATATATCTCGAGATATATCTGATCGTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028790.3-204s21c1
Sequence:CCGGCAGCGAGAATTGGACAAATTACTCGAGTAATTTGTCCAATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-270s1c1
Sequence:CCGGGAGATCAGTATCAAGGTCATACTCGAGTATGACCTTGATACTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028790.1-1174s1c1
Sequence:CCGGCCATATCTGTTAAGGTTGAAACTCGAGTTTCAACCTTAACAGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks