EMAIL THIS PAGE TO A FRIEND

ACOT13

acyl-CoA thioesterase 13

48 Gene Product Result for
Synonyms: PNAS-27 THEM2
UniProtKB ID: Q9NPJ3, F5H2L4, O95549
Gene ID:
Human(55856) Summary: This gene encodes a member of the thioesterase superfamily. In humans, the protein co-localizes with microtubules and is essential for sustained cell proliferation. The orthologous mouse protein forms a homotetramer and is associated with mitochondria. The mouse protein functions as a medium- and long-chain acyl-CoA thioesterase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2009]
Mouse(66834) acyl-CoA thioesterase 13
Rat(291135) acyl-CoA thioesterase 13
naked mole-rat(101721817) acyl-CoA thioesterase 13
domestic guinea pig(100724370) acyl-CoA thioesterase 13
sheep(101118059) acyl-CoA thioesterase 13
Zebrafish(564010) acyl-CoA thioesterase 13
chicken(421006) acyl-CoA thioesterase 13
dog(610883) acyl-CoA thioesterase 13
cow(504870) acyl-CoA thioesterase 13
domestic cat(101087479) acyl-CoA thioesterase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018473 Rosetta Predictions human pricing
NM_001106111 Rosetta Predictions rat pricing
NM_025790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224074 predicted 350
2 SASI_Hs01_00224075 predicted 461
3 SASI_Hs02_00352046 predicted 368
4 SASI_Hs01_00224076 predicted 251
5 SASI_Hs01_00224078 predicted 383
6 SASI_Hs02_00352047 predicted 226
7 SASI_Hs01_00224079 predicted 388
8 SASI_Hs01_00224080 predicted 253
9 SASI_Hs01_00224081 predicted 392
10 SASI_Hs01_00224082 predicted 392
11 SASI_Hs01_00224073 predicted 522
12 SASI_Hs01_00224077 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215732 predicted 493
2 SASI_Rn02_00215733 predicted 364
3 SASI_Rn02_00215734 predicted 250
4 SASI_Rn02_00215735 predicted 502
5 SASI_Rn02_00215736 predicted 436
6 SASI_Rn02_00215737 predicted 416
7 SASI_Rn02_00215738 predicted 476
8 SASI_Rn02_00215739 predicted 246
9 SASI_Rn02_00215740 predicted 247
10 SASI_Rn02_00215741 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120686 predicted 208
2 SASI_Mm01_00120687 predicted 192
3 SASI_Mm01_00120688 predicted 441
4 SASI_Mm01_00120689 predicted 377
5 SASI_Mm01_00120690 predicted 306
6 SASI_Mm01_00120691 predicted 281
7 SASI_Mm01_00120692 predicted 444
8 SASI_Mm01_00120693 predicted 206
9 SASI_Mm01_00120694 predicted 423
10 SASI_Mm01_00120695 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025790
VALIDATED
ACOT13 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 13
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-293s1c1
Sequence:CCGGGAAACTAATCTGTGAGATGAACTCGAGTTCATCTCACAGATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-225s1c1
Sequence:CCGGGTTATGTTCAAAGTTCCCGGTCTCGAGACCGGGAACTTTGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-514s1c1
Sequence:CCGGGAAAGACACTTGCATTTGCCTCTCGAGAGGCAAATGCAAGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-451s1c1
Sequence:CCGGCGTACATGTCACCTGCTAAGACTCGAGTCTTAGCAGGTGACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-311s21c1
Sequence:CCGGAGGTGGAAGAGCAGCATACTACTCGAGTAGTATGCTGCTCTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-468s21c1
Sequence:CCGGGATAGGAGAAGAAATAGTGATCTCGAGATCACTATTTCTTCTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-332s21c1
Sequence:CCGGATAAACTGGGCACGCTCCATGCTCGAGCATGGAGCGTGCCCAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-429s21c1
Sequence:CCGGCAGTGTGGACATGAACATAACCTCGAGGTTATGTTCATGTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-210s21c1
Sequence:CCGGAGAAGTAATGAAGGTTATGTTCTCGAGAACATAACCTTCATTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-524s21c1
Sequence:CCGCCATTTGCCTCAGTGGATCTGACTCGAGTCAGATCCACTGAGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-381s21c1
Sequence:CCGGCATCTCGACCATGGCTCTAATCTCGAGATTAGAGCCATGGTCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025790
VALIDATED
ACOT13 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 13
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-293s1c1
Sequence:CCGGGAAACTAATCTGTGAGATGAACTCGAGTTCATCTCACAGATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-225s1c1
Sequence:CCGGGTTATGTTCAAAGTTCCCGGTCTCGAGACCGGGAACTTTGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-514s1c1
Sequence:CCGGGAAAGACACTTGCATTTGCCTCTCGAGAGGCAAATGCAAGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-451s1c1
Sequence:CCGGCGTACATGTCACCTGCTAAGACTCGAGTCTTAGCAGGTGACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-311s21c1
Sequence:CCGGAGGTGGAAGAGCAGCATACTACTCGAGTAGTATGCTGCTCTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-468s21c1
Sequence:CCGGGATAGGAGAAGAAATAGTGATCTCGAGATCACTATTTCTTCTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-332s21c1
Sequence:CCGGATAAACTGGGCACGCTCCATGCTCGAGCATGGAGCGTGCCCAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-429s21c1
Sequence:CCGGCAGTGTGGACATGAACATAACCTCGAGGTTATGTTCATGTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-210s21c1
Sequence:CCGGAGAAGTAATGAAGGTTATGTTCTCGAGAACATAACCTTCATTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-524s21c1
Sequence:CCGCCATTTGCCTCAGTGGATCTGACTCGAGTCAGATCCACTGAGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-381s21c1
Sequence:CCGGCATCTCGACCATGGCTCTAATCTCGAGATTAGAGCCATGGTCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025790
VALIDATED
ACOT13 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 13
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-293s1c1
Sequence:CCGGGAAACTAATCTGTGAGATGAACTCGAGTTCATCTCACAGATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-225s1c1
Sequence:CCGGGTTATGTTCAAAGTTCCCGGTCTCGAGACCGGGAACTTTGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-514s1c1
Sequence:CCGGGAAAGACACTTGCATTTGCCTCTCGAGAGGCAAATGCAAGTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025790.1-451s1c1
Sequence:CCGGCGTACATGTCACCTGCTAAGACTCGAGTCTTAGCAGGTGACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-311s21c1
Sequence:CCGGAGGTGGAAGAGCAGCATACTACTCGAGTAGTATGCTGCTCTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-468s21c1
Sequence:CCGGGATAGGAGAAGAAATAGTGATCTCGAGATCACTATTTCTTCTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-332s21c1
Sequence:CCGGATAAACTGGGCACGCTCCATGCTCGAGCATGGAGCGTGCCCAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-429s21c1
Sequence:CCGGCAGTGTGGACATGAACATAACCTCGAGGTTATGTTCATGTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-210s21c1
Sequence:CCGGAGAAGTAATGAAGGTTATGTTCTCGAGAACATAACCTTCATTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-524s21c1
Sequence:CCGCCATTTGCCTCAGTGGATCTGACTCGAGTCAGATCCACTGAGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025790.2-381s21c1
Sequence:CCGGCATCTCGACCATGGCTCTAATCTCGAGATTAGAGCCATGGTCGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018473
VALIDATED
ACOT13 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-512s1c1
Sequence:CCGGGATATAGTGATTACAGCACATCTCGAGATGTGCTGTAATCACTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-457s1c1
Sequence:CCGGCGGAGTCAGTGTCGATATGAACTCGAGTTCATATCGACACTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018473.2-353s1c1
Sequence:CCGGGAAGAGCATACCAATGCAATACTCGAGTATTGCATTGGTATGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-841s21c1
Sequence:CCGGTCTAATCATGTGTGATAATTGCTCGAGCAATTATCACACATGATTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-668s21c1
Sequence:CCGGACCTAAAGAAACCCAACAATGCTCGAGCATTGTTGGGTTTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-306s21c1
Sequence:CCGGGAAAGATTACTCTTGTCTCTGCTCGAGCAGAGACAAGAGTAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-922s21c1
Sequence:CCGGCCACTCTCAGTTAAGATTAAACTCGAGTTTAATCTTAACTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-563s21c1
Sequence:CCGGACACTTGCATTTACCTCTGTGCTCGAGCACAGAGGTAAATGCAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018473
VALIDATED
ACOT13 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-512s1c1
Sequence:CCGGGATATAGTGATTACAGCACATCTCGAGATGTGCTGTAATCACTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-457s1c1
Sequence:CCGGCGGAGTCAGTGTCGATATGAACTCGAGTTCATATCGACACTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018473.2-353s1c1
Sequence:CCGGGAAGAGCATACCAATGCAATACTCGAGTATTGCATTGGTATGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-841s21c1
Sequence:CCGGTCTAATCATGTGTGATAATTGCTCGAGCAATTATCACACATGATTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-668s21c1
Sequence:CCGGACCTAAAGAAACCCAACAATGCTCGAGCATTGTTGGGTTTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-306s21c1
Sequence:CCGGGAAAGATTACTCTTGTCTCTGCTCGAGCAGAGACAAGAGTAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-922s21c1
Sequence:CCGGCCACTCTCAGTTAAGATTAAACTCGAGTTTAATCTTAACTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-563s21c1
Sequence:CCGGACACTTGCATTTACCTCTGTGCTCGAGCACAGAGGTAAATGCAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018473
VALIDATED
ACOT13 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-512s1c1
Sequence:CCGGGATATAGTGATTACAGCACATCTCGAGATGTGCTGTAATCACTATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018473.2-457s1c1
Sequence:CCGGCGGAGTCAGTGTCGATATGAACTCGAGTTCATATCGACACTGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018473.2-353s1c1
Sequence:CCGGGAAGAGCATACCAATGCAATACTCGAGTATTGCATTGGTATGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-841s21c1
Sequence:CCGGTCTAATCATGTGTGATAATTGCTCGAGCAATTATCACACATGATTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-668s21c1
Sequence:CCGGACCTAAAGAAACCCAACAATGCTCGAGCATTGTTGGGTTTCTTTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-306s21c1
Sequence:CCGGGAAAGATTACTCTTGTCTCTGCTCGAGCAGAGACAAGAGTAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018473.3-922s21c1
Sequence:CCGGCCACTCTCAGTTAAGATTAAACTCGAGTTTAATCTTAACTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018473.3-563s21c1
Sequence:CCGGACACTTGCATTTACCTCTGTGCTCGAGCACAGAGGTAAATGCAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks