EMAIL THIS PAGE TO A FRIEND

ACOT1

acyl-CoA thioesterase 1

44 Gene Product Result for
Synonyms: ACH2 CTE-1 LACH2
Species: Human ACOT1(641371), Mouse Acot1(26897), Rat Acot1(50559), domestic guinea pig Acot1(100729928), Domestic Rabbit ACOT1(100344258)
UniProtKB ID: Q86TX2, A1L173, Q3I5F9
Gene ID:
Mouse(26897) acyl-CoA thioesterase 1
Rat(50559) acyl-CoA thioesterase 1
domestic guinea pig(100729928) acyl-CoA thioesterase 1
Domestic Rabbit(100344258) acyl-CoA thioesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037161 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU214111 MISSION® esiRNA esiRNA targeting mouse Acot1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037161 Rosetta Predictions human pricing
NM_031315 Rosetta Predictions rat pricing
NM_012006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308223 predicted 1536
2 SASI_Hs01_00244474 predicted 1140
3 SASI_Hs01_00244475 predicted 1063
4 SASI_Hs01_00244476 predicted 1121
5 SASI_Hs01_00244477 predicted 1117
6 SASI_Hs01_00244478 predicted 1053
7 SASI_Hs01_00244479 predicted 1148
8 SASI_Hs01_00244480 predicted 1106
9 SASI_Hs01_00244481 predicted 1060
10 SASI_Hs01_00244482 predicted 1064
11 SASI_Hs01_00244483 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069925 predicted 1312
2 SASI_Rn01_00069926 predicted 876
3 SASI_Rn01_00069927 predicted 839
4 SASI_Rn01_00069928 predicted 268
5 SASI_Rn01_00069929 predicted 1319
6 SASI_Rn01_00069923 predicted 857
7 SASI_Rn01_00069924 predicted 857
8 SASI_Rn01_00069931 predicted 1301
9 SASI_Rn01_00069932 predicted 991
10 SASI_Rn02_00264534 predicted 264
11 SASI_Rn01_00069930 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081105 predicted 611
2 SASI_Mm01_00081114 predicted 857
3 SASI_Mm01_00081107 predicted 611
4 SASI_Mm01_00081108 predicted 873
5 SASI_Mm01_00081110 predicted 790
6 SASI_Mm01_00081112 predicted 565
7 SASI_Mm01_00081113 predicted 799
8 SASI_Mm01_00081106 predicted 1231
9 SASI_Mm02_00321946 predicted 671
10 SASI_Mm01_00081109 predicted 782
11 SASI_Mm01_00081111 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012006
ACOT1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1226s1c1
Sequence:CCGGACAGTTGGGTAGTGAGTGTTTCTCGAGAAACACTCACTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1241s1c1
Sequence:CCGGGTGTTTGCATGTGTCTCCTAACTCGAGTTAGGAGACACATGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-995s1c1
Sequence:CCGGCGAGTTCTATGCTGATGAGATCTCGAGATCTCATCAGCATAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-875s1c1
Sequence:CCGGCAAGGATGTTGTAGATGCTTTCTCGAGAAAGCATCTACAACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012006
ACOT1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1226s1c1
Sequence:CCGGACAGTTGGGTAGTGAGTGTTTCTCGAGAAACACTCACTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1241s1c1
Sequence:CCGGGTGTTTGCATGTGTCTCCTAACTCGAGTTAGGAGACACATGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-995s1c1
Sequence:CCGGCGAGTTCTATGCTGATGAGATCTCGAGATCTCATCAGCATAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-875s1c1
Sequence:CCGGCAAGGATGTTGTAGATGCTTTCTCGAGAAAGCATCTACAACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012006
ACOT1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1226s1c1
Sequence:CCGGACAGTTGGGTAGTGAGTGTTTCTCGAGAAACACTCACTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-1241s1c1
Sequence:CCGGGTGTTTGCATGTGTCTCCTAACTCGAGTTAGGAGACACATGCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-995s1c1
Sequence:CCGGCGAGTTCTATGCTGATGAGATCTCGAGATCTCATCAGCATAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012006.1-875s1c1
Sequence:CCGGCAAGGATGTTGTAGATGCTTTCTCGAGAAAGCATCTACAACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037161
ACOT1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-843s1c1
Sequence:CCGGGCTCAGTCATCCTGAGGTAAACTCGAGTTTACCTCAGGATGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-1026s1c1
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-752s21c1
Sequence:CCGGTGATGGCTCTGGCTTACTATACTCGAGTATAGTAAGCCAGAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-803s21c1
Sequence:CCGGCGCTCCATCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1264s21c1
Sequence:CCGGCCAGAGACAGGGCACTATATTCTCGAGAATATAGTGCCCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1326s21c1
Sequence:CCGGCTTGGTGGGCAGTCCTATTATCTCGAGATAATAGGACTGCCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1198s21c1
Sequence:CCGGTATGCTAATGAGGCCTGTAAACTCGAGTTTACAGGCCTCATTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037161
ACOT1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-843s1c1
Sequence:CCGGGCTCAGTCATCCTGAGGTAAACTCGAGTTTACCTCAGGATGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-1026s1c1
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-752s21c1
Sequence:CCGGTGATGGCTCTGGCTTACTATACTCGAGTATAGTAAGCCAGAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-803s21c1
Sequence:CCGGCGCTCCATCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1264s21c1
Sequence:CCGGCCAGAGACAGGGCACTATATTCTCGAGAATATAGTGCCCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1326s21c1
Sequence:CCGGCTTGGTGGGCAGTCCTATTATCTCGAGATAATAGGACTGCCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1198s21c1
Sequence:CCGGTATGCTAATGAGGCCTGTAAACTCGAGTTTACAGGCCTCATTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037161
ACOT1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-843s1c1
Sequence:CCGGGCTCAGTCATCCTGAGGTAAACTCGAGTTTACCTCAGGATGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037161.1-1026s1c1
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-752s21c1
Sequence:CCGGTGATGGCTCTGGCTTACTATACTCGAGTATAGTAAGCCAGAGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-803s21c1
Sequence:CCGGCGCTCCATCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1264s21c1
Sequence:CCGGCCAGAGACAGGGCACTATATTCTCGAGAATATAGTGCCCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1326s21c1
Sequence:CCGGCTTGGTGGGCAGTCCTATTATCTCGAGATAATAGGACTGCCCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037161.1-1198s21c1
Sequence:CCGGTATGCTAATGAGGCCTGTAAACTCGAGTTTACAGGCCTCATTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks