EMAIL THIS PAGE TO A FRIEND

ACOT2

acyl-CoA thioesterase 2

49 Gene Product Result for
Synonyms: CTE-IA CTE1A MTE1 PTE2 PTE2A ZAP128
UniProtKB ID: P49753, Q3I5F8, Q53EK4, Q9NUX4
Gene ID:
Human(10965) Summary: This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(171210) acyl-CoA thioesterase 2
Rat(192272) acyl-CoA thioesterase 2
dog(490770) acyl-CoA thioesterase 2
cow(785383) acyl-CoA thioesterase 2
cow(511033) acyl-CoA thioesterase 2
domestic cat(101092274) acyl-CoA thioesterase 2
Domestic Rabbit(100344509) acyl-CoA thioesterase 2
domestic guinea pig(100719237) acyl-CoA thioesterase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412796 Anti-ACOT2 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing
SAB2100030 Anti-ACOT2 antibody produced in rabbit affinity isolated antibody bovine, human, rat, mouse, horse, rabbit
western blot pricing
SAB4500184 Anti-ACOT2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006821 Rosetta Predictions human pricing
NM_138907 Rosetta Predictions rat pricing
NM_134188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342369 predicted 209
2 SASI_Hs02_00342370 predicted 986
3 SASI_Hs02_00342371 predicted 274
4 SASI_Hs02_00342372 predicted 325
5 SASI_Hs02_00342373 predicted 265
6 SASI_Hs02_00342374 predicted 266
7 SASI_Hs02_00342375 predicted 280
8 SASI_Hs01_00183240 predicted 1290
9 SASI_Hs01_00183241 predicted 1216
10 SASI_Hs01_00183242 predicted 1269
11 SASI_Hs01_00183243 predicted 1267
12 SASI_Hs01_00183244 predicted 1205
13 SASI_Hs01_00183245 predicted 1294
14 SASI_Hs01_00183246 predicted 1259
15 SASI_Hs01_00183247 predicted 1210
16 SASI_Hs01_00183248 predicted 1214
17 SASI_Hs01_00183249 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268377 predicted 953
2 SASI_Rn02_00268378 predicted 1171
3 SASI_Rn02_00268379 predicted 1005
4 SASI_Rn02_00268380 predicted 1075
5 SASI_Rn02_00268381 predicted 876
6 SASI_Rn02_00268382 predicted 538
7 SASI_Rn02_00268383 predicted 278
8 SASI_Rn02_00268384 predicted 1062
9 SASI_Rn02_00268385 predicted 1057
10 SASI_Rn02_00268386 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339460 predicted 953
2 SASI_Mm02_00339461 predicted 1420
3 SASI_Mm02_00339462 predicted 1768
4 SASI_Mm02_00339463 predicted 1708
5 SASI_Mm02_00339464 predicted 1696
6 SASI_Mm02_00339465 predicted 1766
7 SASI_Mm02_00339466 predicted 1359
8 SASI_Mm02_00339467 predicted 1764
9 SASI_Mm02_00339468 predicted 45
10 SASI_Mm02_00339469 predicted 116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006821
VALIDATED
ACOT2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-833s21c1
Sequence:CCGGTGGGATTGTGGACATGTTCGGCTCGAGCCGAACATGTCCACAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-989s21c1
Sequence:CCGGAGCCATGAACTACTTGCTCAGCTCGAGCTGAGCAAGTAGTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-326s21c1
Sequence:CCGGGCAGGTTGGTCAGATCATTAGCTCGAGCTAATGATCTGACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-623s21c1
Sequence:CCGAACCTTTGGTGCGGCTGGTGAACTCGAGTTCACCAGCCGCACCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1259s1c1
Sequence:CCGGCCTGACCAGAAGAGCTTCATTCTCGAGAATGAAGCTCTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-262s1c1
Sequence:CCGGGCTGTACCAATGGAGCCTGAACTCGAGTTCAGGCTCCATTGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-201s1c1
Sequence:CCGGCAGTTGTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-1429s1c1
Sequence:CCGGGCACTATATTGAGCCTCCTTACTCGAGTAAGGAGGCTCAATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1180s1c2
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006821
VALIDATED
ACOT2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-833s21c1
Sequence:CCGGTGGGATTGTGGACATGTTCGGCTCGAGCCGAACATGTCCACAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-989s21c1
Sequence:CCGGAGCCATGAACTACTTGCTCAGCTCGAGCTGAGCAAGTAGTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-326s21c1
Sequence:CCGGGCAGGTTGGTCAGATCATTAGCTCGAGCTAATGATCTGACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-623s21c1
Sequence:CCGAACCTTTGGTGCGGCTGGTGAACTCGAGTTCACCAGCCGCACCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1259s1c1
Sequence:CCGGCCTGACCAGAAGAGCTTCATTCTCGAGAATGAAGCTCTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-262s1c1
Sequence:CCGGGCTGTACCAATGGAGCCTGAACTCGAGTTCAGGCTCCATTGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-201s1c1
Sequence:CCGGCAGTTGTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-1429s1c1
Sequence:CCGGGCACTATATTGAGCCTCCTTACTCGAGTAAGGAGGCTCAATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1180s1c2
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006821
VALIDATED
ACOT2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-833s21c1
Sequence:CCGGTGGGATTGTGGACATGTTCGGCTCGAGCCGAACATGTCCACAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-989s21c1
Sequence:CCGGAGCCATGAACTACTTGCTCAGCTCGAGCTGAGCAAGTAGTTCATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-326s21c1
Sequence:CCGGGCAGGTTGGTCAGATCATTAGCTCGAGCTAATGATCTGACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006821.4-623s21c1
Sequence:CCGAACCTTTGGTGCGGCTGGTGAACTCGAGTTCACCAGCCGCACCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1259s1c1
Sequence:CCGGCCTGACCAGAAGAGCTTCATTCTCGAGAATGAAGCTCTTCTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-262s1c1
Sequence:CCGGGCTGTACCAATGGAGCCTGAACTCGAGTTCAGGCTCCATTGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-201s1c1
Sequence:CCGGCAGTTGTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006821.3-1429s1c1
Sequence:CCGGGCACTATATTGAGCCTCCTTACTCGAGTAAGGAGGCTCAATATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006821.3-1180s1c2
Sequence:CCGGCGTCAACAGAAATCGCATCAACTCGAGTTGATGCGATTTCTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134188
ACOT2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-963s1c1
Sequence:CCGGCCTTCTGAGAAACCAAGTCAACTCGAGTTGACTTGGTTTCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1353s1c1
Sequence:CCGGACAGTTGGGTAGCAAGAGTTACTCGAGTAACTCTTGCTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-131s1c1
Sequence:CCGGCGCGGACAAATGCGACGCTGACTCGAGTCAGCGTCGCATTTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1332s1c1
Sequence:CCGGGCTCCAGACTTTCTTCCACAACTCGAGTTGTGGAAGAAAGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-46s1c1
Sequence:CCGGAGCAGGTTGTGCCAACAGGATCTCGAGATCCTGTTGGCACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134188
ACOT2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-963s1c1
Sequence:CCGGCCTTCTGAGAAACCAAGTCAACTCGAGTTGACTTGGTTTCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1353s1c1
Sequence:CCGGACAGTTGGGTAGCAAGAGTTACTCGAGTAACTCTTGCTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-131s1c1
Sequence:CCGGCGCGGACAAATGCGACGCTGACTCGAGTCAGCGTCGCATTTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1332s1c1
Sequence:CCGGGCTCCAGACTTTCTTCCACAACTCGAGTTGTGGAAGAAAGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-46s1c1
Sequence:CCGGAGCAGGTTGTGCCAACAGGATCTCGAGATCCTGTTGGCACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134188
ACOT2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-963s1c1
Sequence:CCGGCCTTCTGAGAAACCAAGTCAACTCGAGTTGACTTGGTTTCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1353s1c1
Sequence:CCGGACAGTTGGGTAGCAAGAGTTACTCGAGTAACTCTTGCTACCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-131s1c1
Sequence:CCGGCGCGGACAAATGCGACGCTGACTCGAGTCAGCGTCGCATTTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-1332s1c1
Sequence:CCGGGCTCCAGACTTTCTTCCACAACTCGAGTTGTGGAAGAAAGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134188.2-46s1c1
Sequence:CCGGAGCAGGTTGTGCCAACAGGATCTCGAGATCCTGTTGGCACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks